Transcript: Human NM_001271779.1

Homo sapiens proteasome 26S subunit, non-ATPase 6 (PSMD6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PSMD6 (9861)
Length:
1652
CDS:
188..1516

Additional Resources:

NCBI RefSeq record:
NM_001271779.1
NBCI Gene record:
PSMD6 (9861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143904 CAGGAACTGTCCAGGTTTATT pLKO.1 1340 CDS 100% 15.000 21.000 N PSMD6 n/a
2 TRCN0000292337 CAGGAACTGTCCAGGTTTATT pLKO_005 1340 CDS 100% 15.000 21.000 N PSMD6 n/a
3 TRCN0000145517 GCTGGAATCATATAGGTCATT pLKO.1 1267 CDS 100% 4.950 3.960 N PSMD6 n/a
4 TRCN0000144555 GCAGTACCAAGAAACTATCAA pLKO.1 1438 CDS 100% 5.625 3.938 N PSMD6 n/a
5 TRCN0000292294 GCAGTACCAAGAAACTATCAA pLKO_005 1438 CDS 100% 5.625 3.938 N PSMD6 n/a
6 TRCN0000142957 CTTGAAGTGTTGCACAGTCTT pLKO.1 1085 CDS 100% 4.950 3.465 N PSMD6 n/a
7 TRCN0000343967 CTTGAAGTGTTGCACAGTCTT pLKO_005 1085 CDS 100% 4.950 3.465 N PSMD6 n/a
8 TRCN0000139882 GACAGCCTTTCGCAAGACATA pLKO.1 709 CDS 100% 4.950 3.465 N PSMD6 n/a
9 TRCN0000297976 GACAGCCTTTCGCAAGACATA pLKO_005 709 CDS 100% 4.950 3.465 N PSMD6 n/a
10 TRCN0000139867 GATCAGGAACTGTCCAGGTTT pLKO.1 1337 CDS 100% 4.950 3.465 N PSMD6 n/a
11 TRCN0000121679 GAAACTATCAAGAAAGGAGAT pLKO.1 1448 CDS 100% 4.050 2.835 N PSMD6 n/a
12 TRCN0000139027 CCAATCATTAGCGGTTGTGGA pLKO.1 1162 CDS 100% 2.640 1.848 N PSMD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02262 pDONR223 100% 88% 88% None 146_304del n/a
2 ccsbBroad304_02262 pLX_304 0% 88% 88% V5 146_304del n/a
3 TRCN0000470350 CGGTCAGACGATATGCCCAGTATT pLX_317 41.1% 88% 88% V5 146_304del n/a
Download CSV