Construct: ORF TRCN0000470396
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016090.3_s317c1
- Derived from:
- ccsbBroadEn_14786
- DNA Barcode:
- GGAACTTTCTCCTGTCTCTTCTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRKAR2A (5576)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470396
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5576 | PRKAR2A | protein kinase cAMP-depende... | NM_001321983.2 | 100% | 100% | |
| 2 | human | 5576 | PRKAR2A | protein kinase cAMP-depende... | NM_001321982.2 | 94.5% | 94.5% | 873_938del |
| 3 | human | 5576 | PRKAR2A | protein kinase cAMP-depende... | NM_004157.4 | 94.5% | 94.5% | 873_938del |
| 4 | human | 5576 | PRKAR2A | protein kinase cAMP-depende... | XM_011533942.3 | 94.5% | 94.5% | 873_938del |
| 5 | human | 5576 | PRKAR2A | protein kinase cAMP-depende... | NM_001321989.2 | 87.6% | 87.6% | 350_351ins84;789_854del |
| 6 | human | 5576 | PRKAR2A | protein kinase cAMP-depende... | XM_005265315.4 | 84% | 77% | (many diffs) |
| 7 | human | 5576 | PRKAR2A | protein kinase cAMP-depende... | XM_011533943.2 | 82.8% | 77.9% | (many diffs) |
| 8 | human | 5576 | PRKAR2A | protein kinase cAMP-depende... | XR_002959546.1 | 67.3% | 1_237del;1110_1175del;1450_1701del | |
| 9 | human | 5576 | PRKAR2A | protein kinase cAMP-depende... | XR_002959547.1 | 38.1% | (many diffs) | |
| 10 | mouse | 19087 | Prkar2a | protein kinase, cAMP depend... | NM_008924.2 | 81.6% | 81.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1212
- ORF length:
- 1146
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ccacatccag atcccgccgg ggctcacgga gctgctgcag ggctacacgg 121 tggaggtgct gcgacagcag ccgcctgacc tcgtcgaatt cgcagtggag tacttcaccc 181 gcctgcgcga ggcccgcgcc ccagcctcag tcctgcccgc cgccacccca cgccagagcc 241 tgggccaccc cccgccagaa cccggcccgg accgtgtcgc cgacgccaaa ggggacagcg 301 agtcggagga ggacgaggac ttggaagttc cagttcctag cagatttaat agacgagtat 361 cagtctgtgc tgagacctat aaccctgatg aggaagagga agatacagat ccaagggtga 421 ttcatcctaa aactgatgaa cagagatgca gacttcagga agcttgcaaa gatattctcc 481 ttttcaaaaa tcttgatcag gaacagcttt ctcaagttct cgatgccatg tttgaaagga 541 tagtcaaagc tgatgagcat gtcattgacc aaggagatga tggagacaac ttttatgtca 601 tagaacgggg aacttatgac attttagtaa caaaagataa tcaaacccgc tctgttggtc 661 aatatgacaa ccgtggcagt tttggagaac tagctctgat gtacaacacc ccgagagctg 721 ctaccattgt tgctacctca gaaggctccc tttggggact ggaccgggtg acttttagaa 781 gaatcatagt gaaaaataat gcaaagaaga ggaagatgtt tgaatcattt attGAGTCTG 841 TGCCCCTCCT TAAATCACTA GAGGTGTCAG AACGAATGAA GATTGTGGAT GTAATAGGAG 901 AGAAGATCTA TAAGGATGGA GAACGCATAA TCACTCAGAC TAAATCAAAC AAGGATGGTG 961 GGAACCAGGA GGTCGAGATT GCCCGCTGCC ATAAGGGGCA GTACTTTGGA GAGCTTGCCC 1021 TGGTCACCAA CAAACCCAGA GCTGCCTCAG CTTATGCAGT TGGAGATGTC AAATGCTTAG 1081 TTATGGATGT ACAAGCATTC GAGAGGCTTC TGGGGCCCTG CATGGACATC ATGAAGAGGA 1141 ACATCTCACA CTATGAGGAA CAGCTGGTGA AGATGTTTGG CTCCAGCGTG GATCTGGGCA 1201 ACCTCGGGCA GTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1261 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1321 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGGA ACTTTCTCCT GTCTCTTCTC 1381 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t