Transcript: Human NM_001321982.2

Homo sapiens protein kinase cAMP-dependent type II regulatory subunit alpha (PRKAR2A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PRKAR2A (5576)
Length:
2848
CDS:
279..1493

Additional Resources:

NCBI RefSeq record:
NM_001321982.2
NBCI Gene record:
PRKAR2A (5576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037804 GCAGATTTAATAGACGAGTAT pLKO.1 553 CDS 100% 4.950 6.930 N PRKAR2A n/a
2 TRCN0000195704 CCGCTCTGTTGGTCAATATGA pLKO.1 860 CDS 100% 5.625 3.938 N PRKAR2A n/a
3 TRCN0000024857 GAGATGTCAAATGCTTAGTTA pLKO.1 1342 CDS 100% 5.625 3.938 N Prkar2a n/a
4 TRCN0000345125 GAGATGTCAAATGCTTAGTTA pLKO_005 1342 CDS 100% 5.625 3.938 N Prkar2a n/a
5 TRCN0000037807 GAAAGGATAGTCAAAGCTGAT pLKO.1 747 CDS 100% 4.050 2.835 N PRKAR2A n/a
6 TRCN0000289012 GAAAGGATAGTCAAAGCTGAT pLKO_005 747 CDS 100% 4.050 2.835 N PRKAR2A n/a
7 TRCN0000037806 GCTGAGACCTATAACCCTGAT pLKO.1 582 CDS 100% 4.050 2.835 N PRKAR2A n/a
8 TRCN0000289013 GCTGAGACCTATAACCCTGAT pLKO_005 582 CDS 100% 4.050 2.835 N PRKAR2A n/a
9 TRCN0000037808 TCTTGATTAGAAGCAGGACTA pLKO.1 1201 CDS 100% 4.050 2.835 N PRKAR2A n/a
10 TRCN0000289011 TCTTGATTAGAAGCAGGACTA pLKO_005 1201 CDS 100% 4.050 2.835 N PRKAR2A n/a
11 TRCN0000037805 GCATAATCACTCAGGGTGAAA pLKO.1 1138 CDS 100% 4.950 2.970 N PRKAR2A n/a
12 TRCN0000289065 GCATAATCACTCAGGGTGAAA pLKO_005 1138 CDS 100% 4.950 2.970 N PRKAR2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321982.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11054 pDONR223 100% 94.5% 94.5% None 873_938del n/a
2 ccsbBroad304_11054 pLX_304 0% 94.5% 94.5% V5 873_938del n/a
3 TRCN0000491605 TAACACGCTTGAACACATGTCACC pLX_317 31.1% 94.5% 94.5% V5 873_938del n/a
4 ccsbBroadEn_14786 pDONR223 0% 94.5% 94.5% None 873_938del n/a
5 ccsbBroad304_14786 pLX_304 0% 94.5% 94.5% V5 873_938del n/a
6 TRCN0000470396 GGAACTTTCTCCTGTCTCTTCTCG pLX_317 33.3% 94.5% 94.5% V5 873_938del n/a
Download CSV