Transcript: Mouse NM_008924.2

Mus musculus protein kinase, cAMP dependent regulatory, type II alpha (Prkar2a), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Prkar2a (19087)
Length:
4041
CDS:
315..1523

Additional Resources:

NCBI RefSeq record:
NM_008924.2
NBCI Gene record:
Prkar2a (19087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008924.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024856 GCAAATTTACTAGACGAGTAT pLKO.1 583 CDS 100% 4.950 6.930 N Prkar2a n/a
2 TRCN0000024855 CGAAAGATAATCAAACACGTT pLKO.1 874 CDS 100% 2.640 3.696 N Prkar2a n/a
3 TRCN0000345178 CGAAAGATAATCAAACACGTT pLKO_005 874 CDS 100% 2.640 3.696 N Prkar2a n/a
4 TRCN0000024854 GCCGACAGCTTCTATATCATA pLKO.1 1191 CDS 100% 5.625 3.938 N Prkar2a n/a
5 TRCN0000345179 GCCGACAGCTTCTATATCATA pLKO_005 1191 CDS 100% 5.625 3.938 N Prkar2a n/a
6 TRCN0000024858 CCAGGAATCAGACACGTTCAT pLKO.1 449 CDS 100% 4.950 3.465 N Prkar2a n/a
7 TRCN0000345177 CCAGGAATCAGACACGTTCAT pLKO_005 449 CDS 100% 4.950 3.465 N Prkar2a n/a
8 TRCN0000024857 GAGATGTCAAATGCTTAGTTA pLKO.1 1372 CDS 100% 5.625 3.375 N Prkar2a n/a
9 TRCN0000345125 GAGATGTCAAATGCTTAGTTA pLKO_005 1372 CDS 100% 5.625 3.375 N Prkar2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008924.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11054 pDONR223 100% 81.6% 81.4% None (many diffs) n/a
2 ccsbBroad304_11054 pLX_304 0% 81.6% 81.4% V5 (many diffs) n/a
3 TRCN0000491605 TAACACGCTTGAACACATGTCACC pLX_317 31.1% 81.6% 81.4% V5 (many diffs) n/a
4 ccsbBroadEn_14786 pDONR223 0% 81.6% 81.4% None (many diffs) n/a
5 ccsbBroad304_14786 pLX_304 0% 81.6% 81.4% V5 (many diffs) n/a
6 TRCN0000470396 GGAACTTTCTCCTGTCTCTTCTCG pLX_317 33.3% 81.6% 81.4% V5 (many diffs) n/a
Download CSV