Transcript: Human XM_005265315.4

PREDICTED: Homo sapiens protein kinase cAMP-dependent type II regulatory subunit alpha (PRKAR2A), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKAR2A (5576)
Length:
6311
CDS:
238..1230

Additional Resources:

NCBI RefSeq record:
XM_005265315.4
NBCI Gene record:
PRKAR2A (5576)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144926 GTTGGTCAATATGACAACCG pXPR_003 TGG 605 61% 6 0.6778 PRKAR2A PRKAR2A 77674
2 BRDN0001145818 GCGAATTCGACGAGGTCAGG pXPR_003 CGG 81 8% 1 0.5382 PRKAR2A PRKAR2A 77672
3 BRDN0001145599 TTTGACTATCCTTTCAAACA pXPR_003 TGG 466 47% 5 -0.7994 PRKAR2A PRKAR2A 77673
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265315.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037804 GCAGATTTAATAGACGAGTAT pLKO.1 512 CDS 100% 4.950 6.930 N PRKAR2A n/a
2 TRCN0000380969 TTGCTGTGGTTATGGGCATTT pLKO_005 1428 3UTR 100% 10.800 7.560 N PRKAR2A n/a
3 TRCN0000195704 CCGCTCTGTTGGTCAATATGA pLKO.1 819 CDS 100% 5.625 3.938 N PRKAR2A n/a
4 TRCN0000037807 GAAAGGATAGTCAAAGCTGAT pLKO.1 706 CDS 100% 4.050 2.835 N PRKAR2A n/a
5 TRCN0000289012 GAAAGGATAGTCAAAGCTGAT pLKO_005 706 CDS 100% 4.050 2.835 N PRKAR2A n/a
6 TRCN0000037806 GCTGAGACCTATAACCCTGAT pLKO.1 541 CDS 100% 4.050 2.835 N PRKAR2A n/a
7 TRCN0000289013 GCTGAGACCTATAACCCTGAT pLKO_005 541 CDS 100% 4.050 2.835 N PRKAR2A n/a
8 TRCN0000037805 GCATAATCACTCAGGGTGAAA pLKO.1 1097 CDS 100% 4.950 2.970 N PRKAR2A n/a
9 TRCN0000289065 GCATAATCACTCAGGGTGAAA pLKO_005 1097 CDS 100% 4.950 2.970 N PRKAR2A n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3135 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3135 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3133 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3133 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3133 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3301 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265315.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11054 pDONR223 100% 84% 77% None (many diffs) n/a
2 ccsbBroad304_11054 pLX_304 0% 84% 77% V5 (many diffs) n/a
3 TRCN0000491605 TAACACGCTTGAACACATGTCACC pLX_317 31.1% 84% 77% V5 (many diffs) n/a
4 ccsbBroadEn_14786 pDONR223 0% 84% 77% None (many diffs) n/a
5 ccsbBroad304_14786 pLX_304 0% 84% 77% V5 (many diffs) n/a
6 TRCN0000470396 GGAACTTTCTCCTGTCTCTTCTCG pLX_317 33.3% 84% 77% V5 (many diffs) n/a
Download CSV