Construct: ORF TRCN0000470399
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013525.3_s317c1
- Derived from:
- ccsbBroadEn_14744
- DNA Barcode:
- AATCGTTTATGTAGTTAGTTCAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PFKFB3 (5209)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470399
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_004566.4 | 100% | 100% | |
2 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001314063.2 | 98.2% | 97.3% | (many diffs) |
3 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_017016329.2 | 96.3% | 96.3% | 440_441ins57 |
4 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001145443.3 | 95.8% | 94.8% | (many diffs) |
5 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001282630.2 | 95.4% | 92.7% | (many diffs) |
6 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001323016.2 | 94.1% | 92.1% | (many diffs) |
7 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001363545.2 | 90.4% | 89.2% | (many diffs) |
8 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_005252464.2 | 88.8% | 88.8% | 1341_1342ins174 |
9 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_017016326.2 | 87.1% | 85.9% | (many diffs) |
10 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_017016327.2 | 86.7% | 84.5% | (many diffs) |
11 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_017016328.2 | 84.3% | 83% | (many diffs) |
12 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_011519493.2 | 82.1% | 82.1% | 977_978ins105;1236_1237ins174 |
13 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NM_001323017.2 | 64.8% | 64.8% | 0_1ins549 |
14 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | XM_024448037.1 | 58.3% | 57% | (many diffs) |
15 | human | 5209 | PFKFB3 | 6-phosphofructo-2-kinase/fr... | NR_136554.2 | 28.9% | (many diffs) | |
16 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_133232.3 | 88.4% | 97.6% | (many diffs) |
17 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177754.1 | 87.3% | 95.5% | (many diffs) |
18 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177757.1 | 85.8% | 95% | (many diffs) |
19 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177758.1 | 84.8% | 92.5% | (many diffs) |
20 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | XM_017315954.1 | 83.9% | 93% | (many diffs) |
21 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177755.1 | 83.7% | 92.5% | (many diffs) |
22 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177756.1 | 82.7% | 90.5% | (many diffs) |
23 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177753.1 | 81.4% | 90% | (many diffs) |
24 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | NM_001177752.1 | 78% | 86.7% | (many diffs) |
25 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | XM_006497367.1 | 78% | 85.2% | (many diffs) |
26 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | XM_006497368.2 | 75.1% | 83% | (many diffs) |
27 | mouse | 170768 | Pfkfb3 | 6-phosphofructo-2-kinase/fr... | XM_006497369.2 | 75.1% | 83% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1626
- ORF length:
- 1560
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gttggaactg acgcagagcc gagtgcagaa gatctgggtg cccgtggacc 121 acaggccctc gttgcccaga tcctgtgggc caaagctgac caactccccc accgtcatcg 181 tcatggtggg cctccccgcc cggggcaaga cctacatctc caagaagctg actcgctacc 241 tcaactggat tggcgtcccc acaaaagtgt tcaacgtcgg ggagtatcgc cgggaggctg 301 tgaagcagta cagctcctac aacttcttcc gccccgacaa tgaggaagcc atgaaagtcc 361 ggaagcaatg tgccttagct gccttgagag atgtcaaaag ctacctggcg aaagaagggg 421 gacaaattgc ggttttcgat gccaccaata ctactagaga gaggagacac atgatccttc 481 attttgccaa agaaaatgac tttaaggcgt ttttcatcga gtcggtgtgc gacgacccta 541 cagttgtggc ctccaatatc atggaagtta aaatctccag cccggattac aaagactgca 601 actcggcaga agccatggac gacttcatga agaggatcag ttgctatgaa gccagctacc 661 agcccctcga ccccgacaaa tgcgacaggg acttgtcgct gatcaaggtg attgacgtgg 721 gccggaggtt cctggtgaac cgggtgcagg accacatcca gagccgcatc gtgtactacc 781 tgatgaacat ccacgtgcag ccgcgtacca tctacctgtg ccggcacggc gagaacgagc 841 acaacctcca gggccgcatc gggggcgact caggcctgtc cagccggggc aagaagtttg 901 ccagtgctct gagcaagttc gtggaggagc agaacctgaa ggacctgcgc gtgtggacca 961 gccagctgaa gagcaccatc cagacggccg aggcgctgcg gctgccctac gagcagtgga 1021 aggcgctcaa tgagatcgac gcgggcgtct gtgaggagct gacctacgag gagatcaggg 1081 acacctaccc tgaggagtat gcgctgcggg agcaggacaa gtactattac cgctacccca 1141 ccggggagtc ctaccaggac ctggtccagc gcttggagcc agtgatcatg gagctggagc 1201 ggcaggagaa tgtgctggtc atctgccacc aggccgtccT GCGCTGCCTG CTTGCCTACT 1261 TCCTGGATAA GAGTGCAGAG GAGATGCCCT ACCTGAAATG CCCTCTTCAC ACCGTCCTGA 1321 AACTGACGCC TGTCGCTTAT GGCTGCCGTG TGGAATCCAT CTACCTGAAC GTGGAGTCCG 1381 TCTGCACACA CCGGGAGAGG TCAGAGGATG CAAAGAAGGG ACCTAACCCG CTCATGAGAC 1441 GCAATAGTGT CACCCCGCTA GCCAGCCCCG AACCCACCAA AAAGCCTCGC ATCAACAGCT 1501 TTGAGGAGCA TGTGGCCTCC ACCTCGGCCG CCCTGCCCAG CTGCCTGCCC CCGGAGGTGC 1561 CCACGCAGCT GCCTGGACAA AACATGAAAG GCTCCCGGAG CAGCGCTGAC TCCTCCAGGA 1621 AACACTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1681 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1741 CTTGGCTTTA TATATCTTGT GGAAAGGACG AAATCGTTTA TGTAGTTAGT TCAATACGCG 1801 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt