Transcript: Human XM_011519493.2

PREDICTED: Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PFKFB3 (5209)
Length:
4203
CDS:
330..1613

Additional Resources:

NCBI RefSeq record:
XM_011519493.2
NBCI Gene record:
PFKFB3 (5209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147212 GGATTACAAAGACTGCAACT pXPR_003 CGG 535 42% 7 0.7871 PFKFB3 PFKFB3 76463
2 BRDN0001147151 CGTCGGGGAGTATCGCCGGG pXPR_003 AGG 226 18% 3 0.1109 PFKFB3 PFKFB3 76461
3 BRDN0001146230 AGATGGTACGCGGCTGCACG pXPR_003 TGG 731 57% 8 0.0829 PFKFB3 PFKFB3 76462
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196665 GTGCTTAACTTGGTTGTATTT pLKO.1 3346 3UTR 100% 13.200 18.480 N PFKFB3 n/a
2 TRCN0000007338 CGGGTGCATGATTGTGCTTAA pLKO.1 3333 3UTR 100% 10.800 15.120 N PFKFB3 n/a
3 TRCN0000195391 CGTGTCGGTTCCATTCCATTT pLKO.1 1620 3UTR 100% 10.800 15.120 N PFKFB3 n/a
4 TRCN0000314746 CGTGTCGGTTCCATTCCATTT pLKO_005 1620 3UTR 100% 10.800 15.120 N PFKFB3 n/a
5 TRCN0000379480 AGGAGATGCCCTACCTGAAAT pLKO_005 1438 CDS 100% 13.200 9.240 N PFKFB3 n/a
6 TRCN0000195625 CACGGGCAAAGCTCTTCATTT pLKO.1 3848 3UTR 100% 13.200 9.240 N PFKFB3 n/a
7 TRCN0000381874 TCTCCAGCCCGGATTACAAAG pLKO_005 838 CDS 100% 10.800 7.560 N PFKFB3 n/a
8 TRCN0000314748 TGTCGCTGATCAAGGTGATTG pLKO_005 958 CDS 100% 10.800 7.560 N PFKFB3 n/a
9 TRCN0000195650 CGTGACTGTTTGGTGCATCTT pLKO.1 2082 3UTR 100% 4.950 3.465 N PFKFB3 n/a
10 TRCN0000314747 CGTGACTGTTTGGTGCATCTT pLKO_005 2082 3UTR 100% 4.950 3.465 N PFKFB3 n/a
11 TRCN0000007342 GCAGTACAGCTCCTACAACTT pLKO.1 569 CDS 100% 4.950 3.465 N PFKFB3 n/a
12 TRCN0000007339 GCCTCCAATATCATGGAAGTT pLKO.1 813 CDS 100% 4.950 3.465 N PFKFB3 n/a
13 TRCN0000195113 CCACCAATACTACTAGAGAGA pLKO.1 706 CDS 100% 2.640 1.848 N PFKFB3 n/a
14 TRCN0000007340 CCCGGATTACAAAGACTGCAA pLKO.1 845 CDS 100% 2.640 1.848 N PFKFB3 n/a
15 TRCN0000007341 GCTGCCTTGAGAGATGTCAAA pLKO.1 642 CDS 100% 4.950 2.970 N PFKFB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01180 pDONR223 100% 82.1% 82.1% None 977_978ins105;1236_1237ins174 n/a
2 ccsbBroad304_01180 pLX_304 0% 82.1% 82.1% V5 977_978ins105;1236_1237ins174 n/a
3 TRCN0000468199 ACCGATTTTCGTTTTAACCTCCGA pLX_317 24% 82.1% 82.1% V5 977_978ins105;1236_1237ins174 n/a
4 ccsbBroadEn_14744 pDONR223 0% 82.1% 82.1% None 977_978ins105;1236_1237ins174 n/a
5 ccsbBroad304_14744 pLX_304 0% 82.1% 82.1% V5 977_978ins105;1236_1237ins174 n/a
6 TRCN0000470399 AATCGTTTATGTAGTTAGTTCAAT pLX_317 25.1% 82.1% 82.1% V5 977_978ins105;1236_1237ins174 n/a
7 TRCN0000491399 GACATTTTCTAATGCTGGATTATC pLX_317 25.1% 82.1% 82.1% V5 (not translated due to prior stop codon) 977_978ins105;1236_1237ins174 n/a
8 TRCN0000491854 GAACAGTAACCGCTTATCCGTTTT pLX_317 25% 82% 81.9% V5 977_978ins105;1236_1237ins174;1281_1282insG n/a
Download CSV