Transcript: Mouse XM_006497367.1

PREDICTED: Mus musculus 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (Pfkfb3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pfkfb3 (170768)
Length:
4566
CDS:
230..1837

Additional Resources:

NCBI RefSeq record:
XM_006497367.1
NBCI Gene record:
Pfkfb3 (170768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025417 CCGAATTGTATACTACCTGAT pLKO.1 868 CDS 100% 4.050 5.670 N Pfkfb3 n/a
2 TRCN0000322299 ACCACATCCAGAGCCGAATTG pLKO_005 855 CDS 100% 10.800 8.640 N Pfkfb3 n/a
3 TRCN0000314690 ACCCGCTCATGAGACGCAATA pLKO_005 1617 CDS 100% 10.800 8.640 N PFKFB3 n/a
4 TRCN0000322411 ACCCGCTCATGAGACGCAATA pLKO_005 1617 CDS 100% 10.800 8.640 N Pfkfb3 n/a
5 TRCN0000322361 AGAAGGCACATGATCCTTAAT pLKO_005 566 CDS 100% 13.200 9.240 N Pfkfb3 n/a
6 TRCN0000361967 AGGAGATGCCATACCTGAAAT pLKO_005 1383 CDS 100% 13.200 9.240 N Pfkfb3 n/a
7 TRCN0000361974 GAGCCTGTGATCATGGAATTA pLKO_005 1280 CDS 100% 13.200 9.240 N Pfkfb3 n/a
8 TRCN0000322296 TCAGGGACAAGTTGCACATTC pLKO_005 2343 3UTR 100% 10.800 7.560 N Pfkfb3 n/a
9 TRCN0000381874 TCTCCAGCCCGGATTACAAAG pLKO_005 678 CDS 100% 10.800 7.560 N PFKFB3 n/a
10 TRCN0000361975 TTCCAACGAAAGTGTTCAATG pLKO_005 360 CDS 100% 10.800 7.560 N Pfkfb3 n/a
11 TRCN0000025414 CCACCAATACAACTAGAGAAA pLKO.1 546 CDS 100% 4.950 3.465 N Pfkfb3 n/a
12 TRCN0000025415 GCCTCCAACATCATGGAAGTT pLKO.1 653 CDS 100% 4.950 3.465 N Pfkfb3 n/a
13 TRCN0000025418 GTGTTCAATGTGGGAGAGTAT pLKO.1 371 CDS 100% 4.950 3.465 N Pfkfb3 n/a
14 TRCN0000025416 CCAAGAGAATGTATTGGTCAT pLKO.1 1306 CDS 100% 4.050 2.835 N Pfkfb3 n/a
15 TRCN0000007340 CCCGGATTACAAAGACTGCAA pLKO.1 685 CDS 100% 2.640 1.848 N PFKFB3 n/a
16 TRCN0000322362 ACTTCATGAAGAGAATCAATT pLKO_005 726 CDS 100% 13.200 7.920 N Pfkfb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491854 GAACAGTAACCGCTTATCCGTTTT pLX_317 25% 78% 85.2% V5 (many diffs) n/a
2 ccsbBroadEn_01180 pDONR223 100% 78% 85.2% None (many diffs) n/a
3 ccsbBroad304_01180 pLX_304 0% 78% 85.2% V5 (many diffs) n/a
4 TRCN0000468199 ACCGATTTTCGTTTTAACCTCCGA pLX_317 24% 78% 85.2% V5 (many diffs) n/a
5 ccsbBroadEn_14744 pDONR223 0% 78% 85.2% None (many diffs) n/a
6 ccsbBroad304_14744 pLX_304 0% 78% 85.2% V5 (many diffs) n/a
7 TRCN0000470399 AATCGTTTATGTAGTTAGTTCAAT pLX_317 25.1% 78% 85.2% V5 (many diffs) n/a
8 TRCN0000491399 GACATTTTCTAATGCTGGATTATC pLX_317 25.1% 78% 85.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV