Transcript: Human XM_017016329.2

PREDICTED: Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PFKFB3 (5209)
Length:
4425
CDS:
330..1835

Additional Resources:

NCBI RefSeq record:
XM_017016329.2
NBCI Gene record:
PFKFB3 (5209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147212 GGATTACAAAGACTGCAACT pXPR_003 CGG 478 32% 6 0.7826 PFKFB3 PFKFB3 76463
2 BRDN0001147151 CGTCGGGGAGTATCGCCGGG pXPR_003 AGG 226 15% 3 0.1184 PFKFB3 PFKFB3 76461
3 BRDN0001146230 AGATGGTACGCGGCTGCACG pXPR_003 TGG 674 45% 7 0.1136 PFKFB3 PFKFB3 76462
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016329.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196665 GTGCTTAACTTGGTTGTATTT pLKO.1 3568 3UTR 100% 13.200 18.480 N PFKFB3 n/a
2 TRCN0000007338 CGGGTGCATGATTGTGCTTAA pLKO.1 3555 3UTR 100% 10.800 15.120 N PFKFB3 n/a
3 TRCN0000195391 CGTGTCGGTTCCATTCCATTT pLKO.1 1842 3UTR 100% 10.800 15.120 N PFKFB3 n/a
4 TRCN0000314746 CGTGTCGGTTCCATTCCATTT pLKO_005 1842 3UTR 100% 10.800 15.120 N PFKFB3 n/a
5 TRCN0000314690 ACCCGCTCATGAGACGCAATA pLKO_005 1633 CDS 100% 10.800 8.640 N PFKFB3 n/a
6 TRCN0000322411 ACCCGCTCATGAGACGCAATA pLKO_005 1633 CDS 100% 10.800 8.640 N Pfkfb3 n/a
7 TRCN0000379480 AGGAGATGCCCTACCTGAAAT pLKO_005 1486 CDS 100% 13.200 9.240 N PFKFB3 n/a
8 TRCN0000195625 CACGGGCAAAGCTCTTCATTT pLKO.1 4070 3UTR 100% 13.200 9.240 N PFKFB3 n/a
9 TRCN0000314678 GGAGCAGGACAAGTACTATTA pLKO_005 1316 CDS 100% 13.200 9.240 N PFKFB3 n/a
10 TRCN0000381874 TCTCCAGCCCGGATTACAAAG pLKO_005 781 CDS 100% 10.800 7.560 N PFKFB3 n/a
11 TRCN0000314748 TGTCGCTGATCAAGGTGATTG pLKO_005 901 CDS 100% 10.800 7.560 N PFKFB3 n/a
12 TRCN0000195650 CGTGACTGTTTGGTGCATCTT pLKO.1 2304 3UTR 100% 4.950 3.465 N PFKFB3 n/a
13 TRCN0000314747 CGTGACTGTTTGGTGCATCTT pLKO_005 2304 3UTR 100% 4.950 3.465 N PFKFB3 n/a
14 TRCN0000007342 GCAGTACAGCTCCTACAACTT pLKO.1 569 CDS 100% 4.950 3.465 N PFKFB3 n/a
15 TRCN0000195113 CCACCAATACTACTAGAGAGA pLKO.1 706 CDS 100% 2.640 1.848 N PFKFB3 n/a
16 TRCN0000007340 CCCGGATTACAAAGACTGCAA pLKO.1 788 CDS 100% 2.640 1.848 N PFKFB3 n/a
17 TRCN0000007341 GCTGCCTTGAGAGATGTCAAA pLKO.1 642 CDS 100% 4.950 2.970 N PFKFB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016329.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01180 pDONR223 100% 96.3% 96.3% None 440_441ins57 n/a
2 ccsbBroad304_01180 pLX_304 0% 96.3% 96.3% V5 440_441ins57 n/a
3 TRCN0000468199 ACCGATTTTCGTTTTAACCTCCGA pLX_317 24% 96.3% 96.3% V5 440_441ins57 n/a
4 ccsbBroadEn_14744 pDONR223 0% 96.3% 96.3% None 440_441ins57 n/a
5 ccsbBroad304_14744 pLX_304 0% 96.3% 96.3% V5 440_441ins57 n/a
6 TRCN0000470399 AATCGTTTATGTAGTTAGTTCAAT pLX_317 25.1% 96.3% 96.3% V5 440_441ins57 n/a
7 TRCN0000491399 GACATTTTCTAATGCTGGATTATC pLX_317 25.1% 96.3% 96.3% V5 (not translated due to prior stop codon) 440_441ins57 n/a
8 TRCN0000491854 GAACAGTAACCGCTTATCCGTTTT pLX_317 25% 96.2% 96.1% V5 440_441ins57;1503_1504insG n/a
Download CSV