Construct: ORF TRCN0000470450
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013619.1_s317c1
- Derived from:
- ccsbBroadEn_01971
- DNA Barcode:
- GTGCTGAACACCGTCGATATCCGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TP63 (8626)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470450
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8626 | TP63 | tumor protein p63 | NM_003722.5 | 100% | 100% | |
2 | human | 8626 | TP63 | tumor protein p63 | NM_001329148.2 | 99.4% | 99.2% | 1117_1118insGTACGAAGCGCC |
3 | human | 8626 | TP63 | tumor protein p63 | NM_001329964.1 | 97.7% | 95.6% | (many diffs) |
4 | human | 8626 | TP63 | tumor protein p63 | NM_001114980.2 | 85.7% | 84.1% | (many diffs) |
5 | human | 8626 | TP63 | tumor protein p63 | NM_001114978.2 | 81.4% | 80.8% | (many diffs) |
6 | human | 8626 | TP63 | tumor protein p63 | NM_001329144.2 | 74.8% | 73.3% | (many diffs) |
7 | human | 8626 | TP63 | tumor protein p63 | NM_001329146.2 | 73.1% | 71.7% | (many diffs) |
8 | human | 8626 | TP63 | tumor protein p63 | NM_001114979.2 | 69.8% | 65.3% | (many diffs) |
9 | human | 8626 | TP63 | tumor protein p63 | NM_001114981.2 | 67.2% | 65% | (many diffs) |
10 | human | 8626 | TP63 | tumor protein p63 | NM_001329145.2 | 60.5% | 57.5% | (many diffs) |
11 | human | 8626 | TP63 | tumor protein p63 | NM_001329149.2 | 60% | 56.8% | (many diffs) |
12 | human | 8626 | TP63 | tumor protein p63 | NM_001114982.2 | 55.7% | 49.8% | (many diffs) |
13 | human | 8626 | TP63 | tumor protein p63 | NM_001329150.2 | 47.3% | 44.6% | (many diffs) |
14 | mouse | 22061 | Trp63 | transformation related prot... | NM_001127259.1 | 91.2% | 97.9% | (many diffs) |
15 | mouse | 22061 | Trp63 | transformation related prot... | XM_006522000.2 | 90.6% | 97.2% | (many diffs) |
16 | mouse | 22061 | Trp63 | transformation related prot... | NM_011641.2 | 78.2% | 82.7% | (many diffs) |
17 | mouse | 22061 | Trp63 | transformation related prot... | NM_001127264.1 | 77.6% | 82% | (many diffs) |
18 | mouse | 22061 | Trp63 | transformation related prot... | XM_006522001.3 | 75% | 81.1% | (many diffs) |
19 | mouse | 22061 | Trp63 | transformation related prot... | NM_001127260.1 | 74.5% | 79.4% | (many diffs) |
20 | mouse | 22061 | Trp63 | transformation related prot... | XM_006522002.1 | 63.5% | 64.3% | (many diffs) |
21 | mouse | 22061 | Trp63 | transformation related prot... | NM_001127261.1 | 63% | 63.6% | (many diffs) |
22 | mouse | 22061 | Trp63 | transformation related prot... | NM_001127262.1 | 61.5% | 64.2% | (many diffs) |
23 | mouse | 22061 | Trp63 | transformation related prot... | NM_001127263.1 | 50.7% | 49.5% | (many diffs) |
24 | mouse | 22061 | Trp63 | transformation related prot... | NM_001127265.1 | 50.1% | 48.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2106
- ORF length:
- 2040
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ttttgaaact tcacggtgtg ccaccctaca gtactgccct gacccttaca 121 tccagcgttt cgtagaaacc ccagctcatt tctcttggaa agaaagttat taccgatcca 181 ccatgtccca gagcacacag acaaatgaat tcctcagtcc agaggttttc cagcatatct 241 gggattttct ggaacagcct atatgttcag ttcagcccat tgacttgaac tttgtggatg 301 aaccatcaga agatggtgcg acaaacaaga ttgagattag catggactgt atccgcatgc 361 aggactcgga cctgagtgac cccatgtggc cacagtacac gaacctgggg ctcctgaaca 421 gcatggacca gcagattcag aacggctcct cgtccaccag tccctataac acagaccacg 481 cgcagaacag cgtcacggcg ccctcgccct acgcacagcc cagctccacc ttcgatgctc 541 tctctccatc acccgccatc ccctccaaca ccgactaccc aggcccgcac agtttcgacg 601 tgtccttcca gcagtcgagc accgccaagt cggccacctg gacgtattcc actgaactga 661 agaaactcta ctgccaaatt gcaaagacat gccccatcca gatcaaggtg atgaccccac 721 ctcctcaggg agctgttatc cgcgccatgc ctgtctacaa aaaagctgag cacgtcacgg 781 aggtggtgaa gcggtgcccc aaccatgagc tgagccgtga attcaacgag ggacagattg 841 cccctcctag tcatttgatt cgagtagagg ggaacagcca tgcccagtat gtagaagatc 901 ccatcacagg aagacagagt gtgctggtac cttatgagcc accccaggtt ggcactgaat 961 tcacgacagt cttgtacaat ttcatgtgta acagcagttg tgttggaggg atgaaccgcc 1021 gtccaatttt aatcattgtt actctggaaa ccagagatgg gcaagtcctg ggccgacgct 1081 gctttgaggc ccggatctgt gcttgcccag gaagagacag gaaggcggat gaagatagca 1141 tcagaaagca gcaagtttcg gacagtacaa agaacggtga tggtacgaag cgcccgtttc 1201 gtcagaacac acatggtatc cagatgacat ccatcaagaa acgaagatcc ccagatgatg 1261 aactgttata cttaccagtg aggggccgtg agacttatga aatgctgttg aagatcaaag 1321 agtccctgga actcatgcag taccttcctc agcacacaat tgaaacgtac aggcaacagc 1381 aacagcagca gcaccagcac ttacttcaga aacagacctc aatacagtct ccatcttcat 1441 atggtaacag ctccccacct ctgaacaaaa tgaacagcat gaacaagctg ccttctgtga 1501 gccagcttat caaccctcag cagcgcaacg ccctcactcc tacaaccatt cctgatggca 1561 tgggagccaa cattcccatg atgggcaccc acatgccaat ggctggagac atgaatggac 1621 tcagccccac ccaggcactc cctcccccac tctccatgcc atccacctcc cACTGCACAC 1681 CCCCACCTCC GTATCCCACA GATTGCAGCA TTGTCAGTTT CTTAGCGAGG TTGGGCTGTT 1741 CATCATGTCT GGACTATTTC ACGACCCAGG GGCTGACCAC CATCTATCAG ATTGAGCATT 1801 ACTCCATGGA TGATCTGGCA AGTCTGAAAA TCCCTGAGCA ATTTCGACAT GCGATCTGGA 1861 AGGGCATCCT GGACCACCGG CAGCTCCACG AATTCTCCTC CCCTTCTCAT CTCCTGCGGA 1921 CCCCAAGCAG TGCCTCTACA GTCAGTGTGG GCTCCAGTGA GACCCGGGGT GAGCGTGTTA 1981 TTGATGCTGT GCGATTCACC CTCCGCCAGA CCATCTCTTT CCCACCCCGA GATGAGTGGA 2041 ATGACTTCAA CTTTGACATG GATGCTCGCC GCAATAAGCA ACAGCGCATC AAAGAGGAGG 2101 GGGAGTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 2161 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 2221 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGTGCTGAAC ACCGTCGATA TCCGGACGCG 2281 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt