Transcript: Mouse NM_001127263.1

Mus musculus transformation related protein 63 (Trp63), transcript variant 7, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Trp63 (22061)
Length:
1729
CDS:
145..1326

Additional Resources:

NCBI RefSeq record:
NM_001127263.1
NBCI Gene record:
Trp63 (22061)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001127263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423330 GAATGAACAGACGTCCAATTT pLKO_005 806 CDS 100% 13.200 18.480 N Trp63 n/a
2 TRCN0000012752 CCCAGTCATCTGATTCGAGTA pLKO.1 643 CDS 100% 4.050 5.670 N Trp63 n/a
3 TRCN0000012749 CCGTCAGAATACACACGGAAT pLKO.1 996 CDS 100% 4.050 5.670 N Trp63 n/a
4 TRCN0000430674 AGATGTTGCTGAAGATCAAAG pLKO_005 1097 CDS 100% 10.800 7.560 N Trp63 n/a
5 TRCN0000430928 AGTCAGCCACCTGGACGTATT pLKO_005 425 CDS 100% 10.800 7.560 N Trp63 n/a
6 TRCN0000012750 CCCAGTATGTAGAAGATCCTA pLKO.1 680 CDS 100% 3.000 2.100 N Trp63 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01971 pDONR223 100% 50.7% 49.5% None (many diffs) n/a
2 ccsbBroad304_01971 pLX_304 0% 50.7% 49.5% V5 (many diffs) n/a
3 TRCN0000470450 GTGCTGAACACCGTCGATATCCGG pLX_317 21.6% 50.7% 49.5% V5 (many diffs) n/a
Download CSV