Transcript: Human NM_001329145.2

Homo sapiens tumor protein p63 (TP63), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TP63 (8626)
Length:
4438
CDS:
143..1393

Additional Resources:

NCBI RefSeq record:
NM_001329145.2
NBCI Gene record:
TP63 (8626)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329145.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006506 CCGTTTCGTCAGAACACACAT pLKO.1 989 CDS 100% 4.950 6.930 N TP63 n/a
2 TRCN0000420642 CATCTGACCTGGCATCTAATT pLKO_005 1818 3UTR 100% 13.200 9.240 N TP63 n/a
3 TRCN0000431014 AGTTGCACTTATTGACCATTT pLKO_005 2084 3UTR 100% 10.800 7.560 N TP63 n/a
4 TRCN0000006504 GAGTGGAATGACTTCAACTTT pLKO.1 1590 3UTR 100% 5.625 3.938 N TP63 n/a
5 TRCN0000006502 GCCACATCAAACCTTTGAGTA pLKO.1 2248 3UTR 100% 4.950 3.465 N TP63 n/a
6 TRCN0000006503 CCTAGTCATTTGATTCGAGTA pLKO.1 641 CDS 100% 4.050 2.835 N TP63 n/a
7 TRCN0000012750 CCCAGTATGTAGAAGATCCTA pLKO.1 678 CDS 100% 3.000 2.100 N Trp63 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329145.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01971 pDONR223 100% 60.5% 57.5% None (many diffs) n/a
2 ccsbBroad304_01971 pLX_304 0% 60.5% 57.5% V5 (many diffs) n/a
3 TRCN0000470450 GTGCTGAACACCGTCGATATCCGG pLX_317 21.6% 60.5% 57.5% V5 (many diffs) n/a
Download CSV