Construct: ORF TRCN0000470466
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002684.1_s317c1
- Derived from:
- ccsbBroadEn_01186
- DNA Barcode:
- TCCAGATTTCTTTGATAACCTCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PHB (5245)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470466
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5245 | PHB | prohibitin | NM_001281496.1 | 100% | 100% | |
| 2 | human | 5245 | PHB | prohibitin | NM_001281715.1 | 100% | 100% | |
| 3 | human | 5245 | PHB | prohibitin | NM_002634.4 | 100% | 100% | |
| 4 | human | 5245 | PHB | prohibitin | XM_017024763.1 | 100% | 100% | |
| 5 | human | 5245 | PHB | prohibitin | NM_001281497.1 | 54.7% | 56.9% | (many diffs) |
| 6 | mouse | 18673 | Phb | prohibitin | NM_008831.4 | 91.1% | 99.6% | (many diffs) |
| 7 | mouse | 237880 | 1700071K01Rik | RIKEN cDNA 1700071K01 gene | NM_001033765.2 | 88.9% | 92.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 882
- ORF length:
- 816
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgccaaagtg tttgagtcca ttggcaagtt tggcctggcc ttagctgttg 121 caggaggcgt ggtgaactct gccttatata atgtggatgc tgggcacaga gctgtcatct 181 ttgaccgatt ccgtggagtg caggacattg tggtagggga agggactcat tttctcatcc 241 cgtgggtaca gaaaccaatt atctttgact gccgttctcg accacgtaat gtgccagtca 301 tcactggtag caaagattta cagaatgtca acatcacact gcgcatcctc ttccggcctg 361 tcgccagcca gcttcctcgc atcttcacca gcatcggaga ggactatgat gagcgtgtgc 421 tgccgtccat cacaactgag atcctcaagt cagtggtggc tcgctttgat gctggagaac 481 taatcaccca gagagagctg gtctccaggc aggtgagcga cgaccttaca gagcgagccg 541 ccacctttgg gctcatcctg gatgacgtgt ccttgacaca TCTGACCTTC GGGAAGGAGT 601 TCACAGAAGC GGTGGAAGCC AAACAGGTGG CTCAGCAGGA AGCAGAGAGG GCCAGATTTG 661 TGGTGGAAAA GGCTGAGCAA CAGAAAAAGG CGGCCATCAT CTCTGCTGAG GGCGACTCCA 721 AGGCAGCTGA GCTGATTGCC AACTCACTGG CCACTGCAGG GGATGGCCTG ATCGAGCTGC 781 GCAAGCTGGA AGCTGCAGAG GACATCGCGT ACCAGCTCTC ACGCTCTCGG AACATCACCT 841 ACCTGCCAGC GGGGCAGTCC GTGCTCCTCC AGCTGCCCCA GTGCCCAACT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGATCC AGATTTCTTT GATAACCTCG TACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t