Transcript: Mouse NM_001033765.2

Mus musculus RIKEN cDNA 1700071K01 gene (1700071K01Rik), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
1700071K01Rik (237880)
Length:
1038
CDS:
67..882

Additional Resources:

NCBI RefSeq record:
NM_001033765.2
NBCI Gene record:
1700071K01Rik (237880)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033765.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088269 CGCTCTCAACCACGGAATATA pLKO.1 274 CDS 100% 15.000 21.000 N 1700071K01Rik n/a
2 TRCN0000088272 CAGTTATATTTGACTGTCGCT pLKO.1 257 CDS 100% 0.660 0.924 N 1700071K01Rik n/a
3 TRCN0000088270 CCTCATATCTACACCAACATT pLKO.1 376 CDS 100% 5.625 3.938 N 1700071K01Rik n/a
4 TRCN0000088271 GCCATCTATCACCTCAGAGAT pLKO.1 423 CDS 100% 4.950 3.465 N 1700071K01Rik n/a
5 TRCN0000088268 AGGCCTCCCCTGCTTCACCTT pLKO.1 885 3UTR 100% 0.000 0.000 N 1700071K01Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033765.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01186 pDONR223 100% 88.9% 92.6% None (many diffs) n/a
2 ccsbBroad304_01186 pLX_304 0% 88.9% 92.6% V5 (many diffs) n/a
3 TRCN0000470466 TCCAGATTTCTTTGATAACCTCGT pLX_317 37.3% 88.9% 92.6% V5 (many diffs) n/a
4 ccsbBroadEn_12857 pDONR223 100% 49.3% 47.6% None (many diffs) n/a
5 ccsbBroad304_12857 pLX_304 0% 49.3% 47.6% V5 (many diffs) n/a
6 TRCN0000466640 CTATATCTGCGACTTATCGGCCCC pLX_317 67% 49.3% 47.6% V5 (many diffs) n/a
Download CSV