Transcript: Mouse NM_008831.4

Mus musculus prohibitin (Phb), mRNA.

Source:
NCBI, updated 2017-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phb (18673)
Length:
1815
CDS:
114..932

Additional Resources:

NCBI RefSeq record:
NM_008831.4
NBCI Gene record:
Phb (18673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313177 TCTCCCGCTCTCGGAACATCA pLKO_005 865 CDS 100% 1.650 2.310 N Phb n/a
2 TRCN0000313253 ATCACTTCAGATCTCTAATTA pLKO_005 1046 3UTR 100% 15.000 10.500 N Phb n/a
3 TRCN0000088457 CGTGGTGAACTCTGCTTTGTA pLKO.1 176 CDS 100% 5.625 3.938 N Phb n/a
4 TRCN0000088454 CCTCGTATCTACACCAGCATT pLKO.1 423 CDS 100% 4.950 3.465 N Phb n/a
5 TRCN0000088456 GCCTTCTATCACCACAGAGAT pLKO.1 470 CDS 100% 4.950 3.465 N Phb n/a
6 TRCN0000088455 CGTCAATATCACACTGCGAAT pLKO.1 374 CDS 100% 4.050 2.835 N Phb n/a
7 TRCN0000312198 CGTCAATATCACACTGCGAAT pLKO_005 374 CDS 100% 4.050 2.835 N Phb n/a
8 TRCN0000349879 GAGCGGCAACATTTGGGCTTA pLKO_005 583 CDS 100% 4.050 2.835 N Phb n/a
9 TRCN0000088453 GCCTCCATTCTGCCGTATATT pLKO.1 1232 3UTR 100% 15.000 9.000 N Phb n/a
10 TRCN0000087986 CCTTGGGTACAGAAACCAATT pLKO.1 288 CDS 100% 10.800 6.480 N LOC434849 n/a
11 TRCN0000088442 GAGCCAGATTTGTGGTGGAAA pLKO.1 697 CDS 100% 4.950 2.970 N LOC436226 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01186 pDONR223 100% 91.1% 99.6% None (many diffs) n/a
2 ccsbBroad304_01186 pLX_304 0% 91.1% 99.6% V5 (many diffs) n/a
3 TRCN0000470466 TCCAGATTTCTTTGATAACCTCGT pLX_317 37.3% 91.1% 99.6% V5 (many diffs) n/a
4 ccsbBroadEn_13707 pDONR223 100% 57.7% 56.6% None (many diffs) n/a
5 ccsbBroad304_13707 pLX_304 0% 57.7% 56.6% V5 (many diffs) n/a
6 TRCN0000471347 GTTAATCGACCCTGTTAGTCCATC pLX_317 82% 57.7% 56.6% V5 (many diffs) n/a
7 ccsbBroadEn_12857 pDONR223 100% 49% 49.2% None (many diffs) n/a
8 ccsbBroad304_12857 pLX_304 0% 49% 49.2% V5 (many diffs) n/a
9 TRCN0000466640 CTATATCTGCGACTTATCGGCCCC pLX_317 67% 49% 49.2% V5 (many diffs) n/a
Download CSV