Transcript: Mouse XM_017318603.1

PREDICTED: Mus musculus autophagy related 4A, cysteine peptidase (Atg4a), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atg4a (666468)
Length:
2077
CDS:
238..1197

Additional Resources:

NCBI RefSeq record:
XM_017318603.1
NBCI Gene record:
Atg4a (666468)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179173 GCAGTGTTTCCTAGATAGAAA pLKO.1 351 CDS 100% 5.625 7.875 N Atg4a n/a
2 TRCN0000113286 CGCCTATTATTTCATAGGATT pLKO.1 786 CDS 100% 0.495 0.396 N Atg4a n/a
3 TRCN0000180427 GCCTGATATGCAGATAGCATA pLKO.1 1273 3UTR 100% 0.495 0.396 N Atg4a n/a
4 TRCN0000434188 TTAAGATGCCACAGTCTTTAG pLKO_005 740 CDS 100% 10.800 7.560 N ATG4A n/a
5 TRCN0000073795 CCTGGGCATAAACCAAATCAA pLKO.1 687 CDS 100% 5.625 3.938 N ATG4A n/a
6 TRCN0000180147 CCTGGGCATAAACCAAATCAA pLKO.1 687 CDS 100% 5.625 3.938 N Atg4a n/a
7 TRCN0000113285 CGACAGCAAGTCTTCAGCAAT pLKO.1 1451 3UTR 100% 4.950 3.465 N Atg4a n/a
8 TRCN0000184079 CGACAGCAAGTCTTCAGCAAT pLKO.1 1451 3UTR 100% 4.950 3.465 N Atg4a n/a
9 TRCN0000113287 CGGATACAGATGAGCTGGTAT pLKO.1 60 5UTR 100% 4.950 3.465 N Atg4a n/a
10 TRCN0000113289 GATGTTTGAATTGGTTCAGAA pLKO.1 1038 CDS 100% 4.950 3.465 N Atg4a n/a
11 TRCN0000180428 GCAAGTCTTCAGCAATGGAAA pLKO.1 1456 3UTR 100% 4.950 3.465 N Atg4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04675 pDONR223 100% 72% 74% None (many diffs) n/a
2 ccsbBroad304_04675 pLX_304 0% 72% 74% V5 (many diffs) n/a
3 TRCN0000470578 AACGAGCTAATCGACGCCTGCCAG pLX_317 40.4% 72% 74% V5 (many diffs) n/a
Download CSV