Construct: ORF TRCN0000470600
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014487.1_s317c1
- Derived from:
- ccsbBroadEn_01437
- DNA Barcode:
- ATGAACCCCCCCATTTCGCTGGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPL36AL (6166)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470600
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6166 | RPL36AL | ribosomal protein L36a like | NM_001001.5 | 100% | 100% | |
| 2 | human | 6173 | RPL36A | ribosomal protein L36a | NM_021029.6 | 89.9% | 99% | (many diffs) |
| 3 | human | 100529097 | RPL36A-HNRNPH2 | RPL36A-HNRNPH2 readthrough | NM_001199973.2 | 78.8% | 83.3% | (many diffs) |
| 4 | mouse | 66483 | Rpl36al | ribosomal protein L36A-like | NM_025589.4 | 92.1% | 99% | (many diffs) |
| 5 | mouse | 19982 | Rpl36a | ribosomal protein L36A | NM_019865.5 | 88.3% | 99% | (many diffs) |
| 6 | mouse | 624713 | Gm6525 | predicted pseudogene 6525; ... | NR_036654.1 | 49.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 384
- ORF length:
- 318
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 tgggcatggt caacgtaccT AAAACCCGAA GAACCTTCTG TAAGAAGTGT GGCAAGCATC 121 AGCCTCACAA AGTGACACAG TATAAGAAGG GCAAGGATTC TTTGTATGCC CAGGGAAGGA 181 GGCGCTATGA TCGGAAGCAG AGTGGCTATG GTGGGCAGAC AAAGCCAATT TTCCGGAAGA 241 AGGCTAAGAC CACAAAGAAG ATTGTGCTAA GGCTGGAATG TGTTGAGCCT AACTGCAGAT 301 CCAAGAGGAT GCTGGCCATT AAGAGATGCA AGCATTTTGA ACTGGGAGGA GATAAGAAGA 361 GAAAGGGCCA AGTGATCCAG TTCTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 421 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 481 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA TGAACCCCCC 541 CATTTCGCTG GCAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 601 att