Transcript: Mouse NR_036654.1

Mus musculus predicted pseudogene 6525 (Gm6525), non-coding RNA.

Source:
NCBI, updated 2013-07-17
Taxon:
Mus musculus (mouse)
Gene:
Gm6525 (624713)
Length:
556
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_036654.1
NBCI Gene record:
Gm6525 (624713)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_036654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104104 GTGGGCAGACTAAGCCTATTT pLKO.1 282 3UTR 100% 13.200 6.600 Y Rpl36a n/a
2 TRCN0000426220 GAGCCCAACTGCAGATCTAAG pLKO_005 356 3UTR 100% 10.800 5.400 Y Rpl36a n/a
3 TRCN0000425335 GGCCAAGTGATCCAGTTCTAA pLKO_005 437 3UTR 100% 5.625 2.813 Y RPL36A n/a
4 TRCN0000439424 TTGAATTGGGAGGCGACAAGA pLKO_005 408 3UTR 100% 4.950 2.475 Y Rpl36a n/a
5 TRCN0000104103 GACAGGAAACAGAGTGGCTAT pLKO.1 260 3UTR 100% 4.050 2.025 Y Rpl36a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_036654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06886 pDONR223 100% 51% None (many diffs) n/a
2 ccsbBroad304_06886 pLX_304 0% 51% V5 (many diffs) n/a
3 TRCN0000480052 AGTCATCTCCAACCCCTGGCACAC pLX_317 100% 51% V5 (many diffs) n/a
4 ccsbBroadEn_01437 pDONR223 100% 49.3% None (many diffs) n/a
5 ccsbBroad304_01437 pLX_304 0% 49.3% V5 (many diffs) n/a
6 TRCN0000470600 ATGAACCCCCCCATTTCGCTGGCA pLX_317 93.1% 49.3% V5 (many diffs) n/a
Download CSV