Transcript: Human NM_021029.6

Homo sapiens ribosomal protein L36a (RPL36A), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RPL36A (6173)
Length:
761
CDS:
34..354

Additional Resources:

NCBI RefSeq record:
NM_021029.6
NBCI Gene record:
RPL36A (6173)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021029.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426220 GAGCCCAACTGCAGATCTAAG pLKO_005 253 CDS 100% 10.800 5.400 Y Rpl36a n/a
2 TRCN0000117738 GTGGGCAAACTAAGCCGATTT pLKO.1 179 CDS 100% 10.800 5.400 Y RPL36A n/a
3 TRCN0000117739 TCTAAGAGAATGCTGGCTATT pLKO.1 268 CDS 100% 10.800 5.400 Y RPL36A n/a
4 TRCN0000438606 ACAGGAAGCAGAGTGGCTATG pLKO_005 158 CDS 100% 6.000 3.000 Y RPL36A n/a
5 TRCN0000425780 TACAAAGAAGATTGTGCTAAG pLKO_005 219 CDS 100% 6.000 3.000 Y RPL36A n/a
6 TRCN0000425335 GGCCAAGTGATCCAGTTCTAA pLKO_005 334 CDS 100% 5.625 2.813 Y RPL36A n/a
7 TRCN0000117737 CCATAAAGTGACACAGTACAA pLKO.1 93 CDS 100% 4.950 2.475 Y RPL36A n/a
8 TRCN0000262435 TAAAGTGACACAGTACAAGAA pLKO_005 96 CDS 100% 4.950 2.475 Y RPL36AP8 n/a
9 TRCN0000117741 TGGGAGGAGATAAGAAGAGAA pLKO.1 311 CDS 100% 4.950 2.475 Y RPL36A n/a
10 TRCN0000445431 GCTAAGGCTTGAGTGCGTTGA pLKO_005 234 CDS 100% 4.050 2.025 Y RPL36A n/a
11 TRCN0000262431 GGACTTTCTGTAAGAAGTGTG pLKO_005 59 CDS 100% 4.050 2.025 Y RPL36AP8 n/a
12 TRCN0000117740 CAGTACAAGAAGGGCAAGGAT pLKO.1 106 CDS 100% 3.000 1.500 Y RPL36A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021029.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06886 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_06886 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480052 AGTCATCTCCAACCCCTGGCACAC pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_01437 pDONR223 100% 89.9% 99% None (many diffs) n/a
5 ccsbBroad304_01437 pLX_304 0% 89.9% 99% V5 (many diffs) n/a
6 TRCN0000470600 ATGAACCCCCCCATTTCGCTGGCA pLX_317 93.1% 89.9% 99% V5 (many diffs) n/a
Download CSV