Transcript: Mouse NM_019865.5

Mus musculus ribosomal protein L36A (Rpl36a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rpl36a (19982)
Length:
497
CDS:
64..384

Additional Resources:

NCBI RefSeq record:
NM_019865.5
NBCI Gene record:
Rpl36a (19982)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019865.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104101 GCGGCGTTACGACAGGAAACA pLKO.1 177 CDS 100% 1.650 1.155 N Rpl36a n/a
2 TRCN0000104102 CCACAAGGTGACACAGTACAA pLKO.1 123 CDS 100% 4.950 2.970 N Rpl36a n/a
3 TRCN0000117740 CAGTACAAGAAGGGCAAGGAT pLKO.1 136 CDS 100% 3.000 1.800 N RPL36A n/a
4 TRCN0000104100 GCTGGCTATTAAGAGATGCAA pLKO.1 309 CDS 100% 3.000 1.800 N Rpl36a n/a
5 TRCN0000104104 GTGGGCAGACTAAGCCTATTT pLKO.1 209 CDS 100% 13.200 6.600 Y Rpl36a n/a
6 TRCN0000426220 GAGCCCAACTGCAGATCTAAG pLKO_005 283 CDS 100% 10.800 5.400 Y Rpl36a n/a
7 TRCN0000425335 GGCCAAGTGATCCAGTTCTAA pLKO_005 364 CDS 100% 5.625 2.813 Y RPL36A n/a
8 TRCN0000439424 TTGAATTGGGAGGCGACAAGA pLKO_005 335 CDS 100% 4.950 2.475 Y Rpl36a n/a
9 TRCN0000104103 GACAGGAAACAGAGTGGCTAT pLKO.1 187 CDS 100% 4.050 2.025 Y Rpl36a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019865.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06886 pDONR223 100% 92.7% 100% None (many diffs) n/a
2 ccsbBroad304_06886 pLX_304 0% 92.7% 100% V5 (many diffs) n/a
3 TRCN0000480052 AGTCATCTCCAACCCCTGGCACAC pLX_317 100% 92.7% 100% V5 (many diffs) n/a
4 ccsbBroadEn_01437 pDONR223 100% 88.3% 99% None (many diffs) n/a
5 ccsbBroad304_01437 pLX_304 0% 88.3% 99% V5 (many diffs) n/a
6 TRCN0000470600 ATGAACCCCCCCATTTCGCTGGCA pLX_317 93.1% 88.3% 99% V5 (many diffs) n/a
Download CSV