Construct: ORF TRCN0000470607
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005386.1_s317c1
- Derived from:
- ccsbBroadEn_07987
- DNA Barcode:
- TTTACCTCTATATTCTTCCGTACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ABHD12 (26090)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470607
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26090 | ABHD12 | abhydrolase domain containi... | NM_015600.5 | 99.9% | 100% | 837C>T |
| 2 | human | 26090 | ABHD12 | abhydrolase domain containi... | NM_001042472.3 | 96.5% | 96.2% | (many diffs) |
| 3 | human | 26090 | ABHD12 | abhydrolase domain containi... | XM_011529214.2 | 95.8% | 95.5% | (many diffs) |
| 4 | human | 26090 | ABHD12 | abhydrolase domain containi... | XM_017027796.1 | 57.8% | 57.4% | (many diffs) |
| 5 | human | 26090 | ABHD12 | abhydrolase domain containi... | XM_017027797.2 | 49% | 48.5% | (many diffs) |
| 6 | human | 26090 | ABHD12 | abhydrolase domain containi... | XR_002958465.1 | 37.9% | (many diffs) | |
| 7 | human | 26090 | ABHD12 | abhydrolase domain containi... | XR_002958466.1 | 36.4% | (many diffs) | |
| 8 | human | 26090 | ABHD12 | abhydrolase domain containi... | XR_002958467.1 | 27.8% | (many diffs) | |
| 9 | mouse | 76192 | Abhd12 | abhydrolase domain containi... | NM_024465.3 | 86.2% | 89.8% | (many diffs) |
| 10 | mouse | 76192 | Abhd12 | abhydrolase domain containi... | XM_006500365.3 | 72.6% | 76.6% | (many diffs) |
| 11 | mouse | 76192 | Abhd12 | abhydrolase domain containi... | XM_006500366.3 | 51.6% | 55.6% | (many diffs) |
| 12 | mouse | 76192 | Abhd12 | abhydrolase domain containi... | XM_006500367.3 | 51.6% | 55.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1278
- ORF length:
- 1212
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gaagcggacc gagcccgtcg ccttggagca tgagcgctgc gccgccgcgg 121 gctcgtcctc ctccggctcg gccgccgcgg cgctggacgc cgactgccgc ctgaagcaga 181 acctacgcct gacgggcccg gcggcggctg agccgcgctg cgcagccgac gcgggaatga 241 agcgggcgct gggcaggcga aagggcgtgt ggttgcgcct gaggaagata cttttctgtg 301 ttttggggtt gtacattgcc attccatttc tcatcaaact atgtcctgga atacaggcca 361 aactgatttt cttgaatttc gtaagagttc cctatttcat tgatttgaaa aaaccacagg 421 atcaaggttt gaatcacacg tgtaactact acctgcagcc agaggaagac gtgaccattg 481 gagtctggca caccgtccct gcagtctggt ggaagaacgc ccaaggcaaa gaccagatgt 541 ggtatgagga tgccttggct tccagccacc ctatcattct gtacctgcat gggaacgcag 601 gtaccagagg aggcgaccac cgcgtggagc tttacaaggt gctgagttcc cttggttacc 661 atgtggtcac ctttgactac agaggttggg gtgactcagt gggaacgcca tctgagcggg 721 gcatgaccta tgacgcactc cacgtttttg actggatcaa agcaagaagt ggtgacaacc 781 ccgtgtacat ctggggccac tctctgggca ctggcgtggc gacaaatctg gtgcggcgcc 841 tctgtgagcg agagacgcct ccagatgccc ttatattgga atctccattc actaatatcc 901 gtgaagaagc taagagccat ccatttTCAG TGATATATCG ATACTTCCCT GGGTTTGACT 961 GGTTCTTCCT TGATCCTATT ACAAGTAGTG GAATTAAATT TGCAAATGAT GAAAACGTGA 1021 AGCACATCTC CTGTCCCCTG CTCATCCTGC ACGCTGAGGA CGACCCGGTG GTGCCCTTCC 1081 AGCTTGGCAG AAAGCTCTAT AGCATCGCCG CACCAGCTCG AAGCTTCCGA GATTTCAAAG 1141 TTCAGTTTGT GCCCTTTCAT TCAGACCTTG GCTACAGGCA CAAATACATT TACAAGAGCC 1201 CTGAGCTGCC ACGGATACTG AGACCTCAGC AGGGCCCAGG TTCCAGCCCA GATCCCAGCA 1261 TGTGGTCAGA GCTGGTGTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1321 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1381 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATTTACCT CTATATTCTT 1441 CCGTACCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt