Transcript: Mouse XM_006500365.3

PREDICTED: Mus musculus abhydrolase domain containing 12 (Abhd12), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abhd12 (76192)
Length:
1698
CDS:
56..1090

Additional Resources:

NCBI RefSeq record:
XM_006500365.3
NBCI Gene record:
Abhd12 (76192)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500365.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032260 GCCCTTTCATCTCGGTAGAAA pLKO.1 901 CDS 100% 5.625 4.500 N Abhd12 n/a
2 TRCN0000032262 CCGAGACTTCAAAGTCCAGTT pLKO.1 955 CDS 100% 4.050 3.240 N Abhd12 n/a
3 TRCN0000032261 GTGGTGATAATCCTGTGTATA pLKO.1 597 CDS 100% 13.200 9.240 N Abhd12 n/a
4 TRCN0000075289 CCACAGGATCAAGGTTTGAAT pLKO.1 242 CDS 100% 5.625 3.938 N ABHD12 n/a
5 TRCN0000032263 GCAGTGGAATTAAATTTGCAA pLKO.1 813 CDS 100% 3.000 2.100 N Abhd12 n/a
6 TRCN0000032259 CCCTTATATTGGAGTCTCCAT pLKO.1 696 CDS 100% 2.640 1.848 N Abhd12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500365.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07987 pDONR223 100% 72.6% 76.6% None (many diffs) n/a
2 ccsbBroad304_07987 pLX_304 0% 72.6% 76.6% V5 (many diffs) n/a
3 TRCN0000470607 TTTACCTCTATATTCTTCCGTACC pLX_317 29.3% 72.6% 76.6% V5 (many diffs) n/a
Download CSV