Transcript: Human XM_005262565.4

PREDICTED: Homo sapiens heat shock transcription factor Y-linked 1 (HSFY1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HSFY1 (86614)
Length:
1341
CDS:
249..1220

Additional Resources:

NCBI RefSeq record:
XM_005262565.4
NBCI Gene record:
HSFY1 (86614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262565.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417402 AGCTAGTGAAGAAAGTTTATT pLKO_005 710 CDS 100% 15.000 7.500 Y HSFY2 n/a
2 TRCN0000017780 CCATCACCACTGGACAAATAT pLKO.1 1182 CDS 100% 15.000 7.500 Y HSFY2 n/a
3 TRCN0000017782 GCTAACATGGAGAATCATAAT pLKO.1 672 CDS 100% 13.200 6.600 Y HSFY2 n/a
4 TRCN0000017779 GCTTCACCTATATCTACTTTA pLKO.1 612 CDS 100% 13.200 6.600 Y HSFY2 n/a
5 TRCN0000434211 GTCTGTCTTAAGCAAGTTAAA pLKO_005 512 CDS 100% 13.200 6.600 Y HSFY1 n/a
6 TRCN0000436375 GTGACCAATTCAAGTCTATTT pLKO_005 283 CDS 100% 13.200 6.600 Y HSFY1 n/a
7 TRCN0000416329 GTTCGACAGCTCAACCTTTAT pLKO_005 417 CDS 100% 13.200 6.600 Y HSFY2 n/a
8 TRCN0000418835 GACTCAGACTTACGGTCAATG pLKO_005 218 5UTR 100% 10.800 5.400 Y HSFY1 n/a
9 TRCN0000435693 TAAATCAGTTGACCACTATTC pLKO_005 892 CDS 100% 10.800 5.400 Y HSFY2 n/a
10 TRCN0000017778 CGGTCAATGATTGAAGAACAT pLKO.1 230 5UTR 100% 4.950 2.475 Y HSFY2 n/a
11 TRCN0000017441 GCACTCTCATAGTACCTACAT pLKO.1 917 CDS 100% 4.950 2.475 Y HSFY1 n/a
12 TRCN0000017438 CCAAAGATGAATTAACTGCTT pLKO.1 150 5UTR 100% 2.640 1.320 Y HSFY1 n/a
13 TRCN0000017440 CACCTTTCTGTCAGAAGAGAT pLKO.1 485 CDS 100% 4.950 2.475 Y HSFY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262565.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04487 pDONR223 100% 80.4% 80% None 0_1ins217;4C>A;8_9insCTTTCTCTGAACTTTCC n/a
2 ccsbBroad304_04487 pLX_304 0% 80.4% 80% V5 0_1ins217;4C>A;8_9insCTTTCTCTGAACTTTCC n/a
3 ccsbBroadEn_10279 pDONR223 100% 30.2% 24.6% None (many diffs) n/a
4 ccsbBroad304_10279 pLX_304 0% 30.2% 24.6% V5 (many diffs) n/a
5 TRCN0000470618 TCACACGTATTCGAGTGCGCGGTC pLX_317 37.3% 30.2% 24.6% V5 (many diffs) n/a
Download CSV