Transcript: Human NM_033108.2

Homo sapiens heat shock transcription factor Y-linked 1 (HSFY1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
HSFY1 (86614)
Length:
1448
CDS:
101..1306

Additional Resources:

NCBI RefSeq record:
NM_033108.2
NBCI Gene record:
HSFY1 (86614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417402 AGCTAGTGAAGAAAGTTTATT pLKO_005 796 CDS 100% 15.000 7.500 Y HSFY2 n/a
2 TRCN0000017780 CCATCACCACTGGACAAATAT pLKO.1 1268 CDS 100% 15.000 7.500 Y HSFY2 n/a
3 TRCN0000017781 GCCAGATAAAGATGATGATTT pLKO.1 304 CDS 100% 13.200 6.600 Y HSFY2 n/a
4 TRCN0000017782 GCTAACATGGAGAATCATAAT pLKO.1 758 CDS 100% 13.200 6.600 Y HSFY2 n/a
5 TRCN0000017779 GCTTCACCTATATCTACTTTA pLKO.1 698 CDS 100% 13.200 6.600 Y HSFY2 n/a
6 TRCN0000434211 GTCTGTCTTAAGCAAGTTAAA pLKO_005 598 CDS 100% 13.200 6.600 Y HSFY1 n/a
7 TRCN0000436375 GTGACCAATTCAAGTCTATTT pLKO_005 369 CDS 100% 13.200 6.600 Y HSFY1 n/a
8 TRCN0000416329 GTTCGACAGCTCAACCTTTAT pLKO_005 503 CDS 100% 13.200 6.600 Y HSFY2 n/a
9 TRCN0000418835 GACTCAGACTTACGGTCAATG pLKO_005 206 CDS 100% 10.800 5.400 Y HSFY1 n/a
10 TRCN0000435693 TAAATCAGTTGACCACTATTC pLKO_005 978 CDS 100% 10.800 5.400 Y HSFY2 n/a
11 TRCN0000431462 TTGTTAGAAAGTCCAAGTTAC pLKO_005 266 CDS 100% 10.800 5.400 Y HSFY2 n/a
12 TRCN0000017778 CGGTCAATGATTGAAGAACAT pLKO.1 218 CDS 100% 4.950 2.475 Y HSFY2 n/a
13 TRCN0000017441 GCACTCTCATAGTACCTACAT pLKO.1 1003 CDS 100% 4.950 2.475 Y HSFY1 n/a
14 TRCN0000017438 CCAAAGATGAATTAACTGCTT pLKO.1 138 CDS 100% 2.640 1.320 Y HSFY1 n/a
15 TRCN0000017439 GATCCTTGTTAGAAAGTCCAA pLKO.1 261 CDS 100% 2.640 1.320 Y HSFY1 n/a
16 TRCN0000017440 CACCTTTCTGTCAGAAGAGAT pLKO.1 571 CDS 100% 4.950 2.475 Y HSFY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04487 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04487 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_10279 pDONR223 100% 49.6% 44.5% None (many diffs) n/a
4 ccsbBroad304_10279 pLX_304 0% 49.6% 44.5% V5 (many diffs) n/a
5 TRCN0000470618 TCACACGTATTCGAGTGCGCGGTC pLX_317 37.3% 49.6% 44.5% V5 (many diffs) n/a
Download CSV