Construct: ORF TRCN0000470650
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014818.1_s317c1
- Derived from:
- ccsbBroadEn_11684
- DNA Barcode:
- AATTCCAGTTTGTGAATGGATCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EPB41L3 (23136)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470650
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | NM_001281534.2 | 99.9% | 100% | 1605T>C |
| 2 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025640.2 | 99.5% | 99.5% | 1605T>C;1805_1816del |
| 3 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025637.2 | 98.5% | 98.6% | 1605T>C;1613_1648del |
| 4 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_011525634.3 | 98.1% | 98.1% | 1605T>C;1613_1648del;1841_1852del |
| 5 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_011525637.3 | 97.9% | 97.9% | 1558_1559ins54 |
| 6 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025644.2 | 97.8% | 97.9% | 1337_1338ins54;1551T>C |
| 7 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025620.2 | 97.1% | 97.1% | 1605T>C;1805_1879del |
| 8 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025646.2 | 96.8% | 96.8% | 1605T>C;2406_2407ins81 |
| 9 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025635.2 | 96.3% | 96.4% | 1605T>C;1805_1816del;2418_2419ins81 |
| 10 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025638.2 | 95.9% | 95.8% | 1605T>C;2488_2489insCGCTGGCTCAGGC;2490_2491ins92 |
| 11 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_011525632.3 | 95.8% | 95.8% | 1605T>C;1613_1648del;1841_1915del |
| 12 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025643.2 | 95.5% | 95.5% | 1605T>C;1613_1648del;2442_2443ins81 |
| 13 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025628.2 | 95.4% | 95.4% | 1605T>C;1805_1927del |
| 14 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025641.2 | 94.7% | 94.7% | 1558_1559ins54;2352_2353ins81 |
| 15 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025634.2 | 94.6% | 94.5% | (many diffs) |
| 16 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | NM_001330557.1 | 94.1% | 94.2% | 1605T>C;1613_1648del;1841_1963del |
| 17 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025625.2 | 94.1% | 94.2% | 1605T>C;1613_1648del;1841_1963del |
| 18 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025621.2 | 93.4% | 93.4% | 1558_1559ins54;1751_1873del |
| 19 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_011525626.3 | 92.8% | 92.9% | 1605T>C;1805_2002del |
| 20 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025624.2 | 92.8% | 92.9% | (many diffs) |
| 21 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025623.2 | 92.4% | 92.4% | 1605T>C;1805_1927del;2529_2530ins81 |
| 22 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025629.2 | 92.2% | 92.2% | (many diffs) |
| 23 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025630.2 | 92.2% | 92.2% | (many diffs) |
| 24 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_011525623.3 | 91.6% | 91.7% | 1605T>C;1613_1648del;1841_2038del |
| 25 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025626.2 | 91.5% | 91.5% | (many diffs) |
| 26 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025632.2 | 91.2% | 91.2% | (many diffs) |
| 27 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025633.2 | 91.2% | 91.2% | (many diffs) |
| 28 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | NM_001281533.1 | 90.3% | 90.3% | (many diffs) |
| 29 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025636.2 | 90.3% | 90.3% | (many diffs) |
| 30 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025618.2 | 89.9% | 90% | 1605T>C;1805_2002del;2604_2605ins81 |
| 31 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025622.2 | 89.7% | 89.8% | (many diffs) |
| 32 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025631.2 | 89.6% | 89.5% | (many diffs) |
| 33 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025639.2 | 89.2% | 89.3% | (many diffs) |
| 34 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025619.2 | 89.1% | 89% | (many diffs) |
| 35 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025627.2 | 88.8% | 88.8% | (many diffs) |
| 36 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025642.2 | 88.4% | 88.3% | (many diffs) |
| 37 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | NM_001281535.1 | 87.3% | 87.3% | 0_1ins327;1278T>C |
| 38 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025659.2 | 87.3% | 87.3% | 0_1ins327;1278T>C |
| 39 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025657.2 | 86.1% | 86.2% | 0_1ins327;1278T>C;1286_1321del |
| 40 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025660.2 | 84.1% | 84.1% | (many diffs) |
| 41 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025651.2 | 83.4% | 83.4% | 0_1ins327;1278T>C;1478_1600del |
| 42 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025648.2 | 82.3% | 82.3% | (many diffs) |
| 43 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025655.2 | 81.4% | 81.4% | (many diffs) |
| 44 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025647.2 | 81.1% | 81.2% | 0_1ins327;1278T>C;1478_1675del |
| 45 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025652.2 | 80.3% | 80.3% | (many diffs) |
| 46 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025645.2 | 80.1% | 80.1% | (many diffs) |
| 47 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025654.2 | 79.3% | 79.4% | (many diffs) |
| 48 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025656.2 | 78.5% | 78.4% | (many diffs) |
| 49 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025649.2 | 78.2% | 78.2% | (many diffs) |
| 50 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025658.2 | 77.4% | 77.4% | (many diffs) |
| 51 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025650.2 | 77.2% | 77.3% | (many diffs) |
| 52 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | NM_012307.4 | 76.6% | 76.6% | (many diffs) |
| 53 | human | 23136 | EPB41L3 | erythrocyte membrane protei... | XM_017025653.2 | 75.3% | 75.3% | (many diffs) |
| 54 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_017317238.1 | 82.6% | 87.5% | (many diffs) |
| 55 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249488.1 | 81.5% | 86.4% | (many diffs) |
| 56 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_011246288.1 | 80.7% | 85.7% | (many diffs) |
| 57 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249483.1 | 79% | 83.6% | (many diffs) |
| 58 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249492.1 | 78.9% | 83.5% | (many diffs) |
| 59 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | NM_001355736.1 | 78% | 82.6% | (many diffs) |
| 60 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | NM_013813.2 | 78% | 82.6% | (many diffs) |
| 61 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_017317234.1 | 77.1% | 81.9% | (many diffs) |
| 62 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249494.1 | 77% | 81.6% | (many diffs) |
| 63 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_017317231.1 | 76.9% | 81.4% | (many diffs) |
| 64 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_011246290.1 | 76.8% | 80.8% | (many diffs) |
| 65 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249480.1 | 76.2% | 80.7% | (many diffs) |
| 66 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | NM_001355733.1 | 76.2% | 80.9% | (many diffs) |
| 67 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249485.1 | 76.2% | 80.9% | (many diffs) |
| 68 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249486.1 | 75.9% | 80.5% | (many diffs) |
| 69 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249489.1 | 75.4% | 79.7% | (many diffs) |
| 70 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249487.1 | 74.4% | 78.7% | (many diffs) |
| 71 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249481.1 | 74.2% | 78.7% | (many diffs) |
| 72 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249491.1 | 74.1% | 78.6% | (many diffs) |
| 73 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_017317232.1 | 73.4% | 77.6% | (many diffs) |
| 74 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249490.1 | 72.6% | 77% | (many diffs) |
| 75 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249484.1 | 71.6% | 75.9% | (many diffs) |
| 76 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249495.1 | 71.1% | 74.9% | (many diffs) |
| 77 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_017317239.2 | 69% | 73.5% | (many diffs) |
| 78 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | NM_001355732.1 | 67.2% | 71.8% | (many diffs) |
| 79 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_011246283.1 | 66.8% | 70.7% | (many diffs) |
| 80 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249476.1 | 66.4% | 70.2% | (many diffs) |
| 81 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | NM_001355734.1 | 65.7% | 69.4% | (many diffs) |
| 82 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249475.1 | 64.9% | 68.6% | (many diffs) |
| 83 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_011246279.1 | 64.4% | 68.1% | (many diffs) |
| 84 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | NM_001355735.1 | 64.1% | 68% | (many diffs) |
| 85 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249478.1 | 63.8% | 67.4% | (many diffs) |
| 86 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_011246278.1 | 63% | 66.6% | (many diffs) |
| 87 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249477.1 | 62.7% | 66.2% | (many diffs) |
| 88 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_011246281.1 | 61.5% | 64.9% | (many diffs) |
| 89 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_011246284.1 | 61.2% | 64.8% | (many diffs) |
| 90 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249482.1 | 58% | 61.8% | (many diffs) |
| 91 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_006523612.4 | 51.4% | 53.9% | (many diffs) |
| 92 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_006523613.3 | 51.4% | 53.9% | (many diffs) |
| 93 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_006523614.4 | 51.4% | 53.9% | (many diffs) |
| 94 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_006523615.3 | 51.4% | 53.9% | (many diffs) |
| 95 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_006523616.4 | 51.4% | 53.9% | (many diffs) |
| 96 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_006523611.4 | 50.6% | 53.1% | (many diffs) |
| 97 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_017317227.2 | 50.2% | 52.8% | (many diffs) |
| 98 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249472.1 | 50.2% | 52.8% | (many diffs) |
| 99 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249473.1 | 50.2% | 52.8% | (many diffs) |
| 100 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_006523618.4 | 45.3% | 47.8% | (many diffs) |
| 101 | mouse | 13823 | Epb41l3 | erythrocyte membrane protei... | XM_030249474.1 | 44.1% | 46.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2661
- ORF length:
- 2595
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac gaccgaatct ggatcagact cggaatccaa gccggaccag gaggccgagc 121 cccaggaggc ggcgggggcg caggggcgcg cgggggcgcc cgtgccggag ccgcccaagg 181 aggagcagca gcaggccctg gagcagttcg ccgccgctgc agcgcacagc accccggtgc 241 ggagggaggt cactgacaag gaacaggagt ttgctgccag ggctgcaaaa cagctcgaat 301 atcagcaatt agaagacgat aaactttctc agaaatcatc tagcagtaaa ctctctcggt 361 ctccattaaa gattgtcaaa aagcctaaaa gcatgcagtg caaagtgata cttctcgatg 421 gatcagaata tacctgtgat gtagagaaac gctccagagg acaagtgctg tttgataaag 481 tgtgtgaaca cttgaacttg ctagagaaag actactttgg gcttacgtat cgagatgctg 541 aaaaccagaa gaattggttg gaccctgcta aggaaataaa aaaacaggtt cgaagtggtg 601 cttggcactt ttcatttaat gtgaaatttt atccaccaga ccctgcccaa ctatctgaag 661 atatcaccag gtactacctc tgcttgcagt tgcgagatga catcgtgtcc ggaaggctgc 721 cctgctcctt tgttaccctg gccttgctgg gctcctacac tgtccagtca gagctcggag 781 actatgaccc agatgaatgt gggagcgatt acattagtga gttccgcttt gcaccaaacc 841 acactaaaga actggaagac aaagtgatcg agctgcacaa gagccacaga ggaatgacgc 901 cagcagaagc agagatgcat ttcttggaaa atgccaaaaa attatcaatg tatggggtag 961 atttacatca tgctaaggac tcagaagggg tagaaattat gttaggagtt tgtgcaagtg 1021 gtctgttgat atatcgcgac cggctgcgaa taaacagatt tgcctggccc aaggttctaa 1081 agatttcata caaacggaac aacttttaca ttaagatccg gccgggagag tttgaacaat 1141 ttgaaagcac cattgggttt aagctgccaa accatcgagc tgccaagcgt ttatggaaag 1201 tatgtgttga gcatcataca tttttcagac tactgttacc agaagcacct cccaagaaat 1261 tcctaacctt gggttccaag tttcgttata gtggcaggac acaagcgcaa acgagaagag 1321 ccagtgcgtt gatagatcgc ccagcacctt actttgaacg ctcatccagc aaacgttata 1381 ccatgtctcg cagcttggat ggagcatcag tgaatgaaaa ccatgaaata tacatgaagg 1441 attctatgtc tgctgcagag gttggtactg gccagtacgc cacaacaaaa ggcatctctc 1501 agaccaactt gatcaccact gtgactccgg agaagaaggc tgaggaggag cgggacgagg 1561 aagaggacaa acggaggaag ggggaagaag tcacgcccat ctcggccatc cggcacgagg 1621 gaaagactga cagtgagcgc acggacaccg cagccgacgg ggagaccacc gccactgagg 1681 agctagaaaa aactcaagat gacctgatga aacatcaaac caacattagc gagctgaaaa 1741 gaaccttctt agaaacctca acagacactg ccgtaacgaa tgaatgggag aagaggcttt 1801 ccacctcccc cgtgcgactg gccgccaggc aggaggatgc ccccatgatc gaaccacttg 1861 tccctgaaga gaaaatggaa accaagacgg agtccagtgg aatagagacg gaacccaccg 1921 tgcaccacct gccgcttagc actgagaagg tggtgcagga gaccgtgttg gtggaggagc 1981 ggcgtgtggt gcacgcgagt ggggatgctt cttactcggc gggagacagc ggggatgctg 2041 cagcacagcc cgcattcaca ggcattaaag ggaaagaggg ctctgccttg acggaggggg 2101 ctaaagagga aggaggggag gaggtcgcta aagctgtcct ggaacaggaa gagacagccg 2161 ctgcttcccg tgagcgacaa gaggagcaga gtgcagccat ccacatttca gaaactttgg 2221 aacaaaaacc tcattttgag tccTCAACGG TGAAGACGGA AACCATCAGT TTTGGCAGTG 2281 TTTCACCGGG AGGAGTAAAG CTAGAAATTT CCACGAAGGA AGTGCCAGTA GTTCACACCG 2341 AAACCAAAAC CATCACATAT GAATCATCAC AGGTCGATCC AGGCACAGAT CTGGAGCCAG 2401 GCGTGCTGAT GAGTGCACAG ACGATCACAT CTGAAACCAC CAGTACCACC ACCACTACGC 2461 ACATCACCAA AACTGTGAAA GGGGGCATTT CAGAGACAAG AATTGAGAAG CGAATAGTCA 2521 TCACGGGGGA TGCAGACATT GACCATGACC AGGCGCTGGC TCAGGCAATT AAAGAGGCCA 2581 AAGAGCAGCA CCCTGACATG TCAGTGACCA AAGTAGTGGT CCATAAAGAG ACAGAGATCA 2641 CACCAGAAGA TGGAGAGGAT TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 2701 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 2761 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAATT CCAGTTTGTG 2821 AATGGATCAA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt