Transcript: Human XM_017025626.2

PREDICTED: Homo sapiens erythrocyte membrane protein band 4.1 like 3 (EPB41L3), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPB41L3 (23136)
Length:
3714
CDS:
12..2627

Additional Resources:

NCBI RefSeq record:
XM_017025626.2
NBCI Gene record:
EPB41L3 (23136)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426402 CAGCAATTAGAAGACGATAAA pLKO_005 249 CDS 100% 13.200 18.480 N EPB41L3 n/a
2 TRCN0000116721 CCAAGCGTTTATGGAAAGTAT pLKO.1 1129 CDS 100% 5.625 7.875 N EPB41L3 n/a
3 TRCN0000116720 CGGCTGCGAATAAACAGATTT pLKO.1 987 CDS 100% 13.200 10.560 N EPB41L3 n/a
4 TRCN0000414682 GAATTGACCTTGACCATTAAT pLKO_005 2744 3UTR 100% 15.000 10.500 N EPB41L3 n/a
5 TRCN0000116719 CCGGGAGAGTTTGAACAATTT pLKO.1 1068 CDS 100% 13.200 9.240 N EPB41L3 n/a
6 TRCN0000116718 CCATCCACATTTCAGAAACTT pLKO.1 2266 CDS 100% 5.625 3.938 N EPB41L3 n/a
7 TRCN0000116717 CCCATAATAAAGCAATCTGAT pLKO.1 2788 3UTR 100% 4.950 3.465 N EPB41L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11684 pDONR223 100% 91.5% 91.5% None (many diffs) n/a
2 ccsbBroad304_11684 pLX_304 0% 91.5% 91.5% V5 (many diffs) n/a
3 TRCN0000470650 AATTCCAGTTTGTGAATGGATCAA pLX_317 16.3% 91.5% 91.5% V5 (many diffs) n/a
4 ccsbBroadEn_11683 pDONR223 100% 13.8% 13.8% None 1_327del;691_2613del n/a
5 ccsbBroad304_11683 pLX_304 0% 13.8% 13.8% V5 1_327del;691_2613del n/a
6 TRCN0000479133 TTCGCCAACCGCTTCTTCAACTAC pLX_317 100% 13.8% 13.8% V5 1_327del;691_2613del n/a
Download CSV