Transcript: Mouse XM_030249492.1

PREDICTED: Mus musculus erythrocyte membrane protein band 4.1 like 3 (Epb41l3), transcript variant X41, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Epb41l3 (13823)
Length:
3959
CDS:
299..2824

Additional Resources:

NCBI RefSeq record:
XM_030249492.1
NBCI Gene record:
Epb41l3 (13823)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030249492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091385 GCCTTAACAAACGAGTGGGAA pLKO.1 2027 CDS 100% 2.640 3.696 N Epb41l3 n/a
2 TRCN0000091384 GCTGCGAAACAGCTTGAATAT pLKO.1 539 CDS 100% 13.200 10.560 N Epb41l3 n/a
3 TRCN0000091387 CGGCTTCGAATAAACAGATTT pLKO.1 1298 CDS 100% 13.200 9.240 N Epb41l3 n/a
4 TRCN0000091383 CCCAGATTAGATGTGCCAATA pLKO.1 3302 3UTR 100% 10.800 7.560 N Epb41l3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030249492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11684 pDONR223 100% 78.9% 83.5% None (many diffs) n/a
2 ccsbBroad304_11684 pLX_304 0% 78.9% 83.5% V5 (many diffs) n/a
3 TRCN0000470650 AATTCCAGTTTGTGAATGGATCAA pLX_317 16.3% 78.9% 83.5% V5 (many diffs) n/a
4 ccsbBroadEn_11683 pDONR223 100% 12.4% 13.9% None (many diffs) n/a
5 ccsbBroad304_11683 pLX_304 0% 12.4% 13.9% V5 (many diffs) n/a
6 TRCN0000479133 TTCGCCAACCGCTTCTTCAACTAC pLX_317 100% 12.4% 13.9% V5 (many diffs) n/a
Download CSV