Construct: ORF TRCN0000470658
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010029.1_s317c1
- Derived from:
- ccsbBroadEn_11665
- DNA Barcode:
- CTTTTAGTCAGTTTATGCTCCCGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PDS5B (23047)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470658
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | XM_017020453.1 | 36.6% | 35% | (many diffs) |
| 2 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | XM_017020452.2 | 36.6% | 35% | (many diffs) |
| 3 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | XM_011535000.2 | 35.7% | 34.1% | (many diffs) |
| 4 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | XM_011534999.2 | 35.7% | 34.1% | (many diffs) |
| 5 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | XM_017020451.1 | 35.7% | 34.1% | (many diffs) |
| 6 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | NM_015032.4 | 35.6% | 34.1% | (many diffs) |
| 7 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | XM_017020450.1 | 35.6% | 34.1% | (many diffs) |
| 8 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | XM_005266298.4 | 35.6% | 34.1% | (many diffs) |
| 9 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | XM_017020448.1 | 35.6% | 34.1% | (many diffs) |
| 10 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | XM_017020449.1 | 35.6% | 34.1% | (many diffs) |
| 11 | human | 23047 | PDS5B | PDS5 cohesin associated fac... | XM_011535002.3 | 16.3% | 14.6% | (many diffs) |
| 12 | mouse | 100710 | Pds5b | PDS5 cohesin associated fac... | XM_006504904.1 | 33.1% | 34.3% | (many diffs) |
| 13 | mouse | 100710 | Pds5b | PDS5 cohesin associated fac... | NM_175310.6 | 32.7% | 33.9% | (many diffs) |
| 14 | mouse | 100710 | Pds5b | PDS5 cohesin associated fac... | XM_006504903.1 | 32.7% | 33.9% | (many diffs) |
| 15 | mouse | 100710 | Pds5b | PDS5 cohesin associated fac... | NM_001346503.1 | 32.6% | 33.9% | (many diffs) |
| 16 | mouse | 100710 | Pds5b | PDS5 cohesin associated fac... | XM_006504901.1 | 32.6% | 33.8% | (many diffs) |
| 17 | mouse | 100710 | Pds5b | PDS5 cohesin associated fac... | XM_006504905.2 | 17.4% | 17.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1653
- ORF length:
- 1587
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tcattcaaag actaggacca atgatggaaa aattacatat ccgcctgggg 121 tcaaggaaat atcagataaa atatctaaag aggagatggt gagacgatta aagatggttg 181 tgaaaacttt tatggatatg gaccaggact ctgaagaaga aaaggagctt tatttaaacc 241 tagctttaca tcttgcttca gatttttttc tcaagcatcc tgataaagat gttcgcttac 301 tggtagcctg ctgccttgct gatattttca ggatttatgc tcctgaagct ccttacacat 361 cccctgataa actaaaggat atatttatgt ttataacaag acagttgaag gggctagagg 421 atacaaagag cccacaattc aataggtatt tttatttact tgagaacatt gcttgggtca 481 agtcatataa catatgcttt gagttagaag atagcaatga aattttcacc cagctataca 541 gaaccttatt ttcagttata aacaatggcc acaatcagaa agtccatatg cacatggtag 601 accttatgag ctctattatt tgtgaaggtg atacagtgtc tcaggagctt ttggatacgg 661 ttttagtaaa tctggtacct gctcataaga atttaaacaa gcaagcatat gatttggcaa 721 aggctttact gaagaggaca gctcaagcta ttgagccata tattaccaat ttttttaatc 781 aggttctgat gcttgggaaa acatctatca gcgatttgtc agagcatgtc tttgacttaa 841 ttttggagct ctacaatatt gatagtcatt tgctgctctc tgttttaccc cagcttgaat 901 ttaaattaaa gagcaatgat aatgaggagc gcctacaagt tgttaaacta ctggcaaaaa 961 tgtttggggc aaaggattca gaattggctt ctcaaaacaa gccactttgg cagtgctact 1021 tgggcaggtt taatgatatc aatgtaccaa tccgcctgga atgtgtgaaa tttgctagcc 1081 attgtctcat gaaccatcct gatttagcaa aagacttaac agagtatctt aaagtgaggt 1141 cacatgaccc tGAGGAAGCT ATTAGACATG ATGTTATTGT GTCAATAGTT ACAGCTGCTA 1201 AAAAGGATAT TCTTCTGGTC AATGATCACT TACTTAATTT TGTGAGAGAG AGAACATTAG 1261 ACAAACGATG GAGAGTACGC AAAGAAGCCA TGATGGGACT TGCCCAAATT TATAAGAAAT 1321 ATGCTTTACA GTCAGCAGCT GGAAAAGATG CTGCAAAACA GATAGCATGG ATCAAAGACA 1381 AATTGCTACA TATATATTAT CAAAATAGTA TTGATGATCG ACTACTTGTT GAACGGATCT 1441 TTGCTCAATA CATGGTTCCT CACAATTTAG AAACTACAGA ACGGATGAAA TGCTTATATT 1501 ACTTGTATGC CACACTGGAT TTAAATGCTG TGAAGTATGT TTCAAATATC AAATTCTGTT 1561 CTTTTCATCC TTTGCAATAT ATTGGATTTT ATGGAAAAGA AACTACAAAC ACCTGTATTT 1621 TAAAATGTAA TCTATGTAGT GTAAACATTG TTTACCCAAC TTTCTTGTAC AAAGTGGTTG 1681 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1741 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACT 1801 TTTAGTCAGT TTATGCTCCC GGACGCGTTA AGTCgacaat caacctctgg attacaaaat 1861 ttgtgaaaga tt