Transcript: Mouse XM_006504903.1

PREDICTED: Mus musculus PDS5 cohesin associated factor B (Pds5b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pds5b (100710)
Length:
7394
CDS:
230..4573

Additional Resources:

NCBI RefSeq record:
XM_006504903.1
NBCI Gene record:
Pds5b (100710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191354 CGACATCAAGTAAAGGATTTA pLKO.1 1736 CDS 100% 13.200 18.480 N Pds5b n/a
2 TRCN0000191169 CCCGATAAACTAAAGGATATA pLKO.1 527 CDS 100% 13.200 10.560 N Pds5b n/a
3 TRCN0000191743 GCTCAAGCTATTGAACCATAT pLKO.1 905 CDS 100% 10.800 7.560 N Pds5b n/a
4 TRCN0000022016 CCAGAGTATGTTGTTCCATAT pLKO.1 3191 CDS 100% 10.800 6.480 N PDS5B n/a
5 TRCN0000159276 GAAGAAGAAGAAAGACAAAGA pLKO.1 4205 CDS 100% 4.950 2.475 Y C1orf35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11665 pDONR223 100% 32.7% 33.9% None (many diffs) n/a
2 ccsbBroad304_11665 pLX_304 0% 32.7% 33.9% V5 (many diffs) n/a
3 TRCN0000470658 CTTTTAGTCAGTTTATGCTCCCGG pLX_317 31.8% 32.7% 33.9% V5 (many diffs) n/a
4 ccsbBroadEn_11666 pDONR223 100% 7.5% 7.5% None (many diffs) n/a
5 ccsbBroad304_11666 pLX_304 0% 7.5% 7.5% V5 (many diffs) n/a
6 TRCN0000473837 TCGCTGTTTCTTTCGAGCCGGCCG pLX_317 100% 7.5% 7.5% V5 (many diffs) n/a
Download CSV