Construct: ORF TRCN0000470774
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008047.1_s317c1
- Derived from:
- ccsbBroadEn_00300
- DNA Barcode:
- TGGTAATAGCTAAACAGCCAAAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RCC1 (1104)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470774
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1104 | RCC1 | regulator of chromosome con... | NM_001048199.2 | 100% | 100% | |
| 2 | human | 1104 | RCC1 | regulator of chromosome con... | NM_001269.5 | 100% | 100% | |
| 3 | human | 1104 | RCC1 | regulator of chromosome con... | NM_001048195.3 | 96.1% | 96.1% | 73_123del |
| 4 | human | 1104 | RCC1 | regulator of chromosome con... | NM_001048194.3 | 93.1% | 93.1% | 73_165del |
| 5 | human | 1104 | RCC1 | regulator of chromosome con... | NR_030726.2 | 44.1% | 1_299del;1563_2858del | |
| 6 | human | 1104 | RCC1 | regulator of chromosome con... | NR_030725.2 | 44.1% | 1_303del;1567_2862del | |
| 7 | mouse | 100088 | Rcc1 | regulator of chromosome con... | NM_133878.3 | 89.2% | 93.8% | (many diffs) |
| 8 | mouse | 100088 | Rcc1 | regulator of chromosome con... | NM_001197082.1 | 86.5% | 91% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1329
- ORF length:
- 1263
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc acccaagcgc atagctaaaa gaaggtcccc cccagcagat gccatcccca 121 aaagcaagaa ggtgaaggtc tcacacaggt cccacagcac agaacccggc ttggtgctga 181 cactaggcca gggcgacgtg ggccagctgg ggctgggtga gaatgtgatg gagaggaaga 241 agccggccct ggtatccatt ccggaggatg ttgtgcaggc tgaggctggg ggcatgcaca 301 ccgtgtgtct aagcaaaagt ggccaggtct attccttcgg ctgcaatgat gagggtgccc 361 tgggaaggga cacatcagtg gagggctcgg agatggtccc tgggaaagtg gagctgcaag 421 agaaggtggt acaggtgtca gcaggagaca gtcacacagc agccctcacc gatgatggcc 481 gtgtcttcct ctggggctcc ttccgggaca ataacggtgt gattggactg ttggagccca 541 tgaagaagag catggtgcct gtgcaggtgc agctggatgt gcctgtggta aaggtggcct 601 caggaaacga ccacttggtg atgctgacag ctgatggtga cctctacacc ttgggctgcg 661 gggaacaggg ccagctaggc cgtgtgcctg agttatttgc caaccgtggt ggccggcaag 721 gcctcgaacg actcctggtc cccaagtgtg tgatgctgaa atccagggga agccggggcc 781 acgtgagatt ccaggatgcc ttttgtggtg cctatttcac ctttgccatc tcccatgagg 841 gccacgtgta cggcttcggc ctctccaact accatcagct tGGAACTCCG GGCACAGAAT 901 CTTGCTTCAT ACCCCAGAAC CTAACATCCT TCAAGAATTC CACCAAGTCC TGGGTGGGCT 961 TCTCTGGTGG CCAGCACCAT ACAGTCTGCA TGGATTCGGA AGGAAAAGCA TACAGCCTGG 1021 GCCGGGCTGA GTATGGGCGG CTGGGCCTTG GAGAGGGTGC TGAGGAGAAG AGCATACCCA 1081 CCCTCATCTC CAGGCTGCCT GCTGTCTCCT CGGTGGCTTG TGGGGCCTCT GTGGGGTATG 1141 CTGTGACCAA GGATGGTCGT GTTTTCGCCT GGGGCATGGG CACCAACTAC CAGCTGGGCA 1201 CAGGGCAGGA TGAGGACGCC TGGAGCCCTG TGGAGATGAT GGGCAAACAG CTGGAGAACC 1261 GTGTGGTCTT ATCTGTGTCC AGCGGGGGCC AGCATACAGT CTTATTAGTC AAGGACAAAG 1321 AACAGAGCTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1381 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1441 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATGGTAA TAGCTAAACA GCCAAAACAC 1501 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt