Transcript: Human NR_030726.2

Homo sapiens regulator of chromosome condensation 1 (RCC1), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
RCC1 (1104)
Length:
2858
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_030726.2
NBCI Gene record:
RCC1 (1104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_030726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256876 CATGCACACCGTGTGTCTAAG pLKO_005 527 3UTR 100% 10.800 15.120 N RCC1 n/a
2 TRCN0000267643 GGGACAATAACGGTGTGATTG pLKO_005 739 3UTR 100% 10.800 15.120 N RCC1 n/a
3 TRCN0000157685 CGGGACAATAACGGTGTGATT pLKO.1 738 3UTR 100% 4.950 6.930 N RCC1 n/a
4 TRCN0000256877 TGGAGAACCGTGTGGTCTTAT pLKO_005 1486 3UTR 100% 13.200 10.560 N RCC1 n/a
5 TRCN0000151199 GCAAACAAATGGTACAGTCAT pLKO.1 1995 3UTR 100% 4.950 3.960 N RCC1 n/a
6 TRCN0000256878 ACATGGCTGTGGGCAACTATA pLKO_005 2072 3UTR 100% 13.200 9.240 N RCC1 n/a
7 TRCN0000267625 AGGCCGTGTGCCTGAGTTATT pLKO_005 911 3UTR 100% 13.200 9.240 N RCC1 n/a
8 TRCN0000157754 CATGGCTCACTCAGAGCTATA pLKO.1 1798 3UTR 100% 10.800 7.560 N RCC1 n/a
9 TRCN0000157236 CCTGGCTTTGCCTACTAGAAA pLKO.1 1868 3UTR 100% 5.625 3.938 N RCC1 n/a
10 TRCN0000152440 CCAGAACCTAACATCCTTCAA pLKO.1 1148 3UTR 100% 4.950 3.465 N RCC1 n/a
11 TRCN0000157981 CCCAAGTGTGTGATGCTGAAA pLKO.1 975 3UTR 100% 4.950 3.465 N RCC1 n/a
12 TRCN0000157904 CTGCATGGATTCGGAAGGAAA pLKO.1 1220 3UTR 100% 4.950 3.465 N RCC1 n/a
13 TRCN0000157477 GTCTATTCCTTCGGCTGCAAT pLKO.1 561 3UTR 100% 4.950 3.465 N RCC1 n/a
14 TRCN0000157980 CCAACTACCATCAGCTTGGAA pLKO.1 1099 3UTR 100% 3.000 2.100 N RCC1 n/a
15 TRCN0000157179 GTGAGATTCCAGGATGCCTTT pLKO.1 1017 3UTR 100% 4.050 2.430 N RCC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_030726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00300 pDONR223 100% 44.1% None 1_299del;1563_2858del n/a
2 ccsbBroad304_00300 pLX_304 0% 44.1% V5 1_299del;1563_2858del n/a
3 TRCN0000470774 TGGTAATAGCTAAACAGCCAAAAC pLX_317 35.6% 44.1% V5 1_299del;1563_2858del n/a
Download CSV