Construct: ORF TRCN0000470779
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017997.1_s317c1
- Derived from:
- ccsbBroadEn_14223
- DNA Barcode:
- AATTCCGGGTTTCAACTGATAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PARP6 (56965)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470779
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XM_017022418.2 | 76.3% | 70.6% | 1024_1093del;1155C>A;1160_1425del |
| 2 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XM_011521805.2 | 73.1% | 67.7% | (many diffs) |
| 3 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323519.2 | 59.4% | 55.3% | (many diffs) |
| 4 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323521.2 | 59.4% | 55.3% | (many diffs) |
| 5 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323523.2 | 59.4% | 55.3% | (many diffs) |
| 6 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323524.2 | 59.4% | 55.3% | (many diffs) |
| 7 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323526.2 | 59.4% | 55.3% | (many diffs) |
| 8 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XM_024449998.1 | 59.4% | 55.3% | (many diffs) |
| 9 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323515.2 | 59.3% | 55.2% | (many diffs) |
| 10 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323516.2 | 59.3% | 55.2% | (many diffs) |
| 11 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323530.2 | 59.3% | 55.2% | (many diffs) |
| 12 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XM_024449997.1 | 59.3% | 55.2% | (many diffs) |
| 13 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323522.2 | 57.5% | 53.5% | (many diffs) |
| 14 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323532.2 | 57.5% | 53.5% | (many diffs) |
| 15 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_020214.4 | 57.5% | 53.5% | (many diffs) |
| 16 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XM_024449996.1 | 57.5% | 53.5% | (many diffs) |
| 17 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323525.2 | 57.4% | 53.4% | (many diffs) |
| 18 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323528.2 | 57.4% | 53.4% | (many diffs) |
| 19 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NM_001323531.2 | 57.4% | 53.4% | (many diffs) |
| 20 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XM_024449995.1 | 57.4% | 53.4% | (many diffs) |
| 21 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_429467.4 | 46.1% | (many diffs) | |
| 22 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_001751363.1 | 43.8% | (many diffs) | |
| 23 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_002957665.1 | 43.1% | (many diffs) | |
| 24 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136603.2 | 42.8% | 1_910del;1995C>A;2000_2542del | |
| 25 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136599.2 | 42.6% | (many diffs) | |
| 26 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136608.2 | 41.7% | (many diffs) | |
| 27 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_002957661.1 | 41.5% | 1_987del;2072C>A;2077_2619del | |
| 28 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_001751361.2 | 41.4% | (many diffs) | |
| 29 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136611.2 | 40.9% | 1_1026del;2111C>A;2116_2658del | |
| 30 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_002957660.1 | 40.6% | (many diffs) | |
| 31 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_002957659.1 | 40.5% | (many diffs) | |
| 32 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136607.2 | 40% | (many diffs) | |
| 33 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136610.2 | 39.9% | (many diffs) | |
| 34 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136606.2 | 39.2% | 1_1138del;2223C>A;2228_2770del | |
| 35 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_002957664.1 | 38.5% | (many diffs) | |
| 36 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136594.2 | 38.3% | (many diffs) | |
| 37 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136604.2 | 38.1% | (many diffs) | |
| 38 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136596.2 | 38% | (many diffs) | |
| 39 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_002957663.1 | 37.3% | (many diffs) | |
| 40 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136605.2 | 36.7% | (many diffs) | |
| 41 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_002957662.1 | 36.5% | (many diffs) | |
| 42 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | NR_136609.2 | 35.9% | (many diffs) | |
| 43 | human | 56965 | PARP6 | poly(ADP-ribose) polymerase... | XR_001751362.2 | 35.5% | (many diffs) | |
| 44 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_006511380.3 | 67.5% | 67.9% | (many diffs) |
| 45 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | NM_029922.3 | 56.1% | 55.3% | (many diffs) |
| 46 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_017313533.1 | 56.1% | 55.3% | (many diffs) |
| 47 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_011242800.1 | 56% | 55.2% | (many diffs) |
| 48 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_017313532.1 | 56% | 55.2% | (many diffs) |
| 49 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_011242799.1 | 55% | 55.3% | (many diffs) |
| 50 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_017313531.1 | 55% | 55.3% | (many diffs) |
| 51 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | NM_001205239.1 | 54.3% | 53.5% | (many diffs) |
| 52 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_017313530.1 | 54.3% | 53.5% | (many diffs) |
| 53 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_011242798.1 | 54.2% | 53.4% | (many diffs) |
| 54 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_017313529.1 | 54.2% | 53.4% | (many diffs) |
| 55 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_011242797.1 | 53.4% | 53.7% | (many diffs) |
| 56 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_017313528.1 | 53.4% | 53.7% | (many diffs) |
| 57 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_006511375.2 | 53.3% | 53.6% | (many diffs) |
| 58 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_011242795.1 | 53.3% | 53.6% | (many diffs) |
| 59 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_011242796.1 | 53.3% | 53.6% | (many diffs) |
| 60 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_017313527.1 | 53.3% | 53.6% | (many diffs) |
| 61 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XM_017313534.1 | 49.5% | 48.5% | (many diffs) |
| 62 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | NR_038074.1 | 39.7% | (many diffs) | |
| 63 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XR_001778988.1 | 38.9% | (many diffs) | |
| 64 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XR_870763.1 | 38.9% | (many diffs) | |
| 65 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XR_001778989.1 | 38.3% | (many diffs) | |
| 66 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XR_001778987.1 | 38.2% | (many diffs) | |
| 67 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XR_870762.1 | 36.8% | (many diffs) | |
| 68 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XR_870764.1 | 36.2% | (many diffs) | |
| 69 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | NR_038075.1 | 36.1% | (many diffs) | |
| 70 | mouse | 67287 | Parp6 | poly (ADP-ribose) polymeras... | XR_001778990.1 | 35.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1155
- ORF length:
- 1089
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt tacatcccaa caatggaaac atctgagcaa tgatttcttg aagacccagc 121 aggagaagag gcacagttgg ttcaaggcaa gtggtaccat caagaagttc cgagctggcc 181 tcagcatctt ttcacccatc cccaagtctc ccagtttccc tatcatacag gactccatgc 241 tgaaaggcaa actaggtgta ccagagcttc gggttgggcg cctcatgaac cgttccatct 301 cctgtaccat gaagaacccc aaagtggaag tgtttggcta ccctcccagc ccccaggtca 361 gtggtcactg caagaacatt cccactctgg agtatggatt cctcgttcag atcatgaagt 421 atgcagaaca gaggattcca acattgaatg agtactgtgt ggtgtgtgat gagcagcatg 481 tcttccaaaa tggatctatg ctgaagccag ctgtctgtac tcgtgaacta tgcgttttct 541 ccttctacac actgggcgtc atgtctggag ctgcagagga ggtggccact ggagcagagg 601 tggtggatct gctggtggcc atgtgtaggg cagctttaga gtcccctaga aagagcatca 661 tctttgagcc ttatccctct gtggtggacc ccactgatcc cAAGACTCTG GCCTTTAACC 721 CTAAGAAGAA GAATTATGAG CGGCTTCAGA AAGCTCTGGA TAGTGTGATG TCTATTCGGG 781 AGATGACCCA GGGCTCATAT TTGGAAATCA AGAAACAGAT GGACAAGTTG GATCCCCTGG 841 CCCATCCTCT CCTGCAGTGG ATCATCTCTA GCAACAGGTC ACACATTGTC AAACTACCTC 901 TCAGCAGGCT GAAGTTCATG CACACCTCAC ACCAGTTCCT CCTGCTGAGC AGCCCTCCTG 961 CCAAGGAGGC TCGGTTCCGG ACCGCCAAGA AGCTCTATGG CAGCACCTTT GCCTTCCATG 1021 GGTCCCACAT TGAGAACTGG CATTCGATCC TGCGCAATGG GCTGGTCAAT GCATCCTACA 1081 CCAAACTGCA GGAATGGGAA AAGGACAGCA CAGGATGCCC TCCAAGGATG AGCTGGTCCA 1141 GAGATACAAA AGGATGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1201 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1261 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AATTCCGGGT TTCAACTGAT 1321 AAATACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt