Transcript: Human NM_001323515.2

Homo sapiens poly(ADP-ribose) polymerase family member 6 (PARP6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PARP6 (56965)
Length:
2548
CDS:
439..2274

Additional Resources:

NCBI RefSeq record:
NM_001323515.2
NBCI Gene record:
PARP6 (56965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308098 ACGACTCGGAGGGAGATAATG pLKO_005 470 CDS 100% 13.200 18.480 N PARP6 n/a
2 TRCN0000296176 GGATCCATCTGCCCTCATAAA pLKO_005 2311 3UTR 100% 13.200 18.480 N PARP6 n/a
3 TRCN0000053204 GCTGTCTGTACTCGTGAACTA pLKO.1 1288 CDS 100% 4.950 6.930 N PARP6 n/a
4 TRCN0000289211 GCTGTCTGTACTCGTGAACTA pLKO_005 1288 CDS 100% 4.950 6.930 N PARP6 n/a
5 TRCN0000053206 CCCTATCATACAGGACTCCAT pLKO.1 996 CDS 100% 2.640 3.696 N PARP6 n/a
6 TRCN0000308095 GATGACCCAGGGCTCATATTT pLKO_005 1560 CDS 100% 15.000 10.500 N PARP6 n/a
7 TRCN0000239226 CCTGCAGAGTCGGAATCTAAA pLKO_005 2046 CDS 100% 13.200 9.240 N Parp6 n/a
8 TRCN0000053203 CCCTAGAAAGAGCATCATCTT pLKO.1 1422 CDS 100% 4.950 3.465 N PARP6 n/a
9 TRCN0000053207 CCTCGTTCAGATCATGAAGTA pLKO.1 1179 CDS 100% 4.950 3.465 N PARP6 n/a
10 TRCN0000289212 CCTCGTTCAGATCATGAAGTA pLKO_005 1179 CDS 100% 4.950 3.465 N PARP6 n/a
11 TRCN0000053205 CTCTGGATAGTGTGATGTCTA pLKO.1 1532 CDS 100% 4.950 3.465 N PARP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14223 pDONR223 100% 59.3% 55.2% None (many diffs) n/a
2 ccsbBroad304_14223 pLX_304 0% 59.3% 55.2% V5 (many diffs) n/a
3 TRCN0000470779 AATTCCGGGTTTCAACTGATAAAT pLX_317 41.8% 59.3% 55.2% V5 (many diffs) n/a
4 ccsbBroadEn_12319 pDONR223 100% 17.8% 17.8% None 1_1506del n/a
5 ccsbBroad304_12319 pLX_304 0% 17.8% 17.8% V5 1_1506del n/a
6 TRCN0000470978 AGCATTAGTAGGCACGATACGAAT pLX_317 100% 17.8% 17.8% V5 1_1506del n/a
Download CSV