Transcript: Mouse XM_006511380.3

PREDICTED: Mus musculus poly (ADP-ribose) polymerase family, member 6 (Parp6), transcript variant X22, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Parp6 (67287)
Length:
1868
CDS:
86..1609

Additional Resources:

NCBI RefSeq record:
XM_006511380.3
NBCI Gene record:
Parp6 (67287)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511380.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239227 CAGAGGATTCCAACGTTAAAT pLKO_005 509 CDS 100% 15.000 21.000 N Parp6 n/a
2 TRCN0000239226 CCTGCAGAGTCGGAATCTAAA pLKO_005 1381 CDS 100% 13.200 18.480 N Parp6 n/a
3 TRCN0000239228 GAAGCATCTGAGCAATGATTT pLKO_005 106 CDS 100% 13.200 18.480 N Parp6 n/a
4 TRCN0000239229 GCCTTATGAATCGTTCCATTT pLKO_005 300 CDS 100% 10.800 15.120 N Parp6 n/a
5 TRCN0000308095 GATGACCCAGGGCTCATATTT pLKO_005 862 CDS 100% 15.000 10.500 N PARP6 n/a
6 TRCN0000239230 GGATCCATCTGCCCTTGTAAA pLKO_005 1645 3UTR 100% 13.200 9.240 N Parp6 n/a
7 TRCN0000053205 CTCTGGATAGTGTGATGTCTA pLKO.1 834 CDS 100% 4.950 3.465 N PARP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511380.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14223 pDONR223 100% 67.5% 67.9% None (many diffs) n/a
2 ccsbBroad304_14223 pLX_304 0% 67.5% 67.9% V5 (many diffs) n/a
3 TRCN0000470779 AATTCCGGGTTTCAACTGATAAAT pLX_317 41.8% 67.5% 67.9% V5 (many diffs) n/a
4 ccsbBroadEn_12319 pDONR223 100% 20.8% 21.4% None (many diffs) n/a
5 ccsbBroad304_12319 pLX_304 0% 20.8% 21.4% V5 (many diffs) n/a
6 TRCN0000470978 AGCATTAGTAGGCACGATACGAAT pLX_317 100% 20.8% 21.4% V5 (many diffs) n/a
Download CSV