Construct: ORF TRCN0000470794
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006209.1_s317c1
- Derived from:
- ccsbBroadEn_13310
- DNA Barcode:
- ATAGGCCGCTATTCTGAACGATTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP54 (159195)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470794
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_005269582.2 | 45.8% | 45.8% | 1_2565del;4000G>C |
2 | human | 159195 | USP54 | ubiquitin specific peptidas... | NM_001350995.2 | 45.6% | 45.6% | 1_2445del;3880_4021delinsC |
3 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447852.1 | 45.6% | 45.6% | 1_2445del;3880_4021delinsC |
4 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447851.1 | 44.7% | 44.7% | 1_2682del;4117G>C |
5 | human | 159195 | USP54 | ubiquitin specific peptidas... | NM_001320437.2 | 44.6% | 44.4% | (many diffs) |
6 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015783.1 | 44.5% | 44.4% | 1_2565del;4000_4141delinsC |
7 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015784.1 | 44.5% | 44.4% | 1_2565del;4000_4141delinsC |
8 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015782.2 | 44% | 44% | 1_2616del;4051_4192delinsC |
9 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_011539368.2 | 43.9% | 43.9% | 1_2631del;4066_4207delinsC |
10 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447849.1 | 43.6% | 43.6% | 1_2802del;4237G>C |
11 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447848.1 | 43.4% | 43.4% | 1_2682del;4117_4258delinsC |
12 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447850.1 | 43.3% | 43.3% | 1_2802del;4222_4223insTGCGTACTTCTCAGC |
13 | human | 159195 | USP54 | ubiquitin specific peptidas... | NM_152586.3 | 43% | 42.9% | 1_2736del;4171_4312delinsC |
14 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015774.1 | 43% | 42.9% | 1_2736del;4171_4312delinsC |
15 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015775.1 | 43% | 42.9% | 1_2736del;4171_4312delinsC |
16 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_017015777.1 | 43% | 42.9% | 1_2736del;4171_4312delinsC |
17 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447847.1 | 43% | 42.9% | 1_2736del;4171_4312delinsC |
18 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447846.1 | 42.5% | 42.3% | (many diffs) |
19 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447832.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
20 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447833.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
21 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447834.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
22 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447835.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
23 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447836.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
24 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447837.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
25 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447838.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
26 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447839.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
27 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447840.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
28 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447841.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
29 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447842.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
30 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447843.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
31 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447844.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
32 | human | 159195 | USP54 | ubiquitin specific peptidas... | XM_024447845.1 | 42.4% | 42.4% | 1_2802del;4237_4378delinsC |
33 | human | 159195 | USP54 | ubiquitin specific peptidas... | NR_135250.1 | 39% | (many diffs) | |
34 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747048.1 | 37.8% | 1_2331del;3766_3907delinsC;4648_5741del | |
35 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747042.1 | 36.7% | 1_2502del;3937_4078delinsC;4819_5912del | |
36 | human | 159195 | USP54 | ubiquitin specific peptidas... | NR_146998.2 | 36.2% | 1_2728del;4163G>C;4904_5997del | |
37 | human | 159195 | USP54 | ubiquitin specific peptidas... | NR_146997.2 | 35.4% | 1_2728del;4163_4304delinsC;5045_6138del | |
38 | human | 159195 | USP54 | ubiquitin specific peptidas... | NR_135249.2 | 33.9% | 1_3132del;4567G>C;5308_6401del | |
39 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747041.2 | 31.8% | 1_3407del;4842_4983delinsC;5724_6817del | |
40 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747037.2 | 28.9% | 1_4093del;5528_5669delinsC;6410_7503del | |
41 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747046.1 | 27.8% | 1_4385del;5820_5961delinsC;6702_7795del | |
42 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747043.1 | 27.7% | 1_4556del;5991G>C;6732_7825del | |
43 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747035.1 | 27% | 1_4622del;6057_6198delinsC;6939_8032del | |
44 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747038.1 | 25.6% | 1_5055del;6490_6631delinsC;7372_8465del | |
45 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747047.1 | 24.3% | (many diffs) | |
46 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747039.1 | 24.2% | 1_5686del;7121G>C;7862_8955del | |
47 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_002956962.1 | 24.1% | 1_5581del;7016_7157delinsC;7898_8991del | |
48 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747044.1 | 24.1% | 1_5686del;7106_7107insTGCGTACTTCTCAGC;7847_8940del | |
49 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_001747036.1 | 24% | 1_5752del;7187G>C;7928_9021del | |
50 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_002956959.1 | 23.7% | 1_5752del;7187_7328delinsC;8069_9162del | |
51 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_002956960.1 | 20.6% | 1_5752del;7172_7173insTGCGTACTTCTCAGC;7386_7387ins526 | |
52 | human | 159195 | USP54 | ubiquitin specific peptidas... | XR_002956961.1 | 18.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2244
- ORF length:
- 2175
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggatacagag tttggggcca gttctttctt ccattcacct gcttcctgcc 121 atgagtcaca ctcatcacta tctccagagt catctgcccc acagcacagc tcccccagta 181 gatctgcctt gaagcttctg acttcggttg aagtagacaa cattgaaccc tctgcattcc 241 acaggcaagg tttacctaaa gcaccagggt ggactgagaa gaattctcat catagttggg 301 agccattgga tgccccagag ggtaagctgc aaggctctag gtgtgacaac agcagttgca 361 gcaagctccc tccacaagaa ggaagaggca ttgctcaaga acagctgttc caagaaaaga 421 aggatcctgc taacccctcc ccggtgatgc ctggaatagc cacctctgag aggggtgatg 481 aacacagcct aggctgtagt ccttcaaatt catcagctca gcccagcctt cccctgtata 541 gaacctgcca ccccataatg cctgttgctt cttcatttgt gcttcactgt cctgatcctg 601 tgcagaaaac taaccaatgc ctccaaggcc aaagcctcaa aacttcattg actttaaaag 661 tggacagagg cagtgaggag acctataggc cagagtttcc cagcacaaag gggcttgtcc 721 gttctctggc tgagcagttc cagaggatgc agggtgtctc catgagggat agtacaggtt 781 tcaaggatag aagtttgtca ggtagtctaa ggaagaactc ttccccttct gattctaagc 841 ctcctttctc acagggtcaa gagaaaggcc actggccatg ggcaaagcaa caatcctctc 901 tggagggtgg ggatagacca ctttcctggg aagagtccac tgaacattct tctcttgcct 961 taaactctgg gctgcctaat ggtgaaactt ctagcggagg acagcccagg ttggcagagc 1021 cagacatata ccaagagaag ctgtcccaag tgagagatgt taggtctaag gatctgggca 1081 gcagtactga cttggggact tccttgcctt tggattcctg ggtgaatatc acaaggttct 1141 gtgattctca gcttaagcat ggggcaccta ggccaggaat gaagtcctcc cctcatgatt 1201 cccatacgtg tgtaacctat ccagagagaa atcacatcct tttgcatcca cattggaacc 1261 aagacacaga gcaggagacc tcagaattgg agtctctgta tcaggccagt cttcaggctt 1321 ctcaagctgg ctgttctgga tgggggcagc aggataccgc ctggcaccca cttagccaaa 1381 caggctctgc agatggcatg gggaggaggt tgcactcagc ccatgatcct ggtctctcaa 1441 agacttcaac agcagaaatg gagcatggtc tccatgaagc cagaacagtg cgtacttctc 1501 agcattcatc aaacgtgagg aagcctttgg aaaccgggca ccgttgttcc agctcctctt 1561 ccctccctgt catccatgac ccttctgtgt ttctcctcgg tccccaactc taccttcccc 1621 aaccacagtt cctgtcccca gatgtcctga tgcccaccat ggcaggggag cccaatagac 1681 tcccaggaac ttcaaggagt gtccagcagt ttctggctat gtgtgacagg ggtgaaactt 1741 cccaaggggc caagtacaca ggaaggactt tgaactacca gagccTCCCC CATCGCTCCA 1801 GAACAGACAA CTCCTGGGCA CCCTGGTCAG AGACCAACCA GCATATTGGG ACCAGATTCC 1861 TGACTACTCC AGGGTGCAAT CCTCAACTAA CCTACACTGC CACACTACCA GAAAGAAGCA 1921 AGGGCCTTCA GGTTCCTCAC ACTCAGTCCT GGAGTGATCT TTTCCATTCA CCCTCCCACC 1981 CTCCCATTGT TCATCCTGTG TACCCACCAT CTAGCAGTCT TCATGTACCC CTGAGGTCAG 2041 CTTGGAATTC AGATCCTGTT CCAGGGTCCC GAACCCCTGG TCCTCGAAGA GTAGATATGC 2101 CCCCAGATGA TGACTGGAGG CAAAGCAGTT ATGCCTCCCA CTCTGGACAC AGGAGAACAG 2161 TGGGAGAGGG GTTTCTGTTT GTTCTATCAG ATGCTCCCAG AAGAGAGCAG ATCAGGGCTA 2221 GAGTCCTGCA GCACAGTCAA TGGTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 2281 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 2341 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA TAGGCCGCTA 2401 TTCTGAACGA TTTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 2461 att