Transcript: Human XM_024447851.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 54 (USP54), transcript variant X27, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP54 (159195)
Length:
9217
CDS:
3267..8126

Additional Resources:

NCBI RefSeq record:
XM_024447851.1
NBCI Gene record:
USP54 (159195)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420371 TTCATCCAGATGGTACATTAT pLKO_005 3798 CDS 100% 13.200 18.480 N USP54 n/a
2 TRCN0000038857 CCACAGGCAAGGTTTACCTAA pLKO.1 6119 CDS 100% 4.950 6.930 N USP54 n/a
3 TRCN0000038858 CATGAGGGATAGTACAGGTTT pLKO.1 6641 CDS 100% 4.950 3.960 N USP54 n/a
4 TRCN0000430244 GCCACCTTCTTACGACATTAA pLKO_005 5192 CDS 100% 13.200 9.240 N USP54 n/a
5 TRCN0000038854 GTTCTGTGATTCTCAGCTTAA pLKO.1 7016 CDS 100% 10.800 7.560 N USP54 n/a
6 TRCN0000038856 GCTGTAGTCCTTCAAATTCAT pLKO.1 6373 CDS 100% 5.625 3.938 N USP54 n/a
7 TRCN0000038855 CCAGCATATTGGGACCAGATT pLKO.1 7718 CDS 100% 4.950 3.465 N USP54 n/a
8 TRCN0000425001 AGGGTGTCAGGAACCTCTAAA pLKO_005 8574 3UTR 100% 13.200 7.920 N USP54 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 8201 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 8201 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000030912 GCTCTGGCAAAGACTTTCCAA pLKO.1 3570 CDS 100% 3.000 2.400 N Usp54 n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 8365 3UTR 100% 10.800 5.400 Y SMIM11A n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 8199 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 8199 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 8199 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13310 pDONR223 100% 44.7% 44.7% None 1_2682del;4117G>C n/a
2 ccsbBroad304_13310 pLX_304 0% 44.7% 44.7% V5 1_2682del;4117G>C n/a
3 TRCN0000470794 ATAGGCCGCTATTCTGAACGATTT pLX_317 21.3% 44.7% 44.7% V5 1_2682del;4117G>C n/a
4 TRCN0000488105 AGTGCTTGTTGTCAAGCATAGGAG pLX_317 14% 44.4% 44.4% V5 (not translated due to prior stop codon) 1_2682del;4102_4116del n/a
5 TRCN0000492028 GACGGTAGGTTTTTAAAGGTTAAT pLX_317 17.8% 44.4% 44.4% V5 1_2682del;4102_4116del;4857_4858insG n/a
Download CSV