Transcript: Human XR_001747037.2

PREDICTED: Homo sapiens ubiquitin specific peptidase 54 (USP54), transcript variant X35, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP54 (159195)
Length:
7503
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747037.2
NBCI Gene record:
USP54 (159195)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420371 TTCATCCAGATGGTACATTAT pLKO_005 2205 3UTR 100% 13.200 18.480 N USP54 n/a
2 TRCN0000038857 CCACAGGCAAGGTTTACCTAA pLKO.1 4264 3UTR 100% 4.950 6.930 N USP54 n/a
3 TRCN0000038858 CATGAGGGATAGTACAGGTTT pLKO.1 4786 3UTR 100% 4.950 3.960 N USP54 n/a
4 TRCN0000430244 GCCACCTTCTTACGACATTAA pLKO_005 3533 3UTR 100% 13.200 9.240 N USP54 n/a
5 TRCN0000038854 GTTCTGTGATTCTCAGCTTAA pLKO.1 5161 3UTR 100% 10.800 7.560 N USP54 n/a
6 TRCN0000038856 GCTGTAGTCCTTCAAATTCAT pLKO.1 4518 3UTR 100% 5.625 3.938 N USP54 n/a
7 TRCN0000038855 CCAGCATATTGGGACCAGATT pLKO.1 6004 3UTR 100% 4.950 3.465 N USP54 n/a
8 TRCN0000425001 AGGGTGTCAGGAACCTCTAAA pLKO_005 6860 3UTR 100% 13.200 7.920 N USP54 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6487 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6487 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000030912 GCTCTGGCAAAGACTTTCCAA pLKO.1 1977 3UTR 100% 3.000 2.400 N Usp54 n/a
12 TRCN0000190964 CCTCTCAAGTGCTGGGATTAA pLKO.1 80 3UTR 100% 13.200 7.920 N Nop16 n/a
13 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 6651 3UTR 100% 10.800 5.400 Y SMIM11A n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6485 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6485 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6485 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13310 pDONR223 100% 28.9% None 1_4093del;5528_5669delinsC;6410_7503del n/a
2 ccsbBroad304_13310 pLX_304 0% 28.9% V5 1_4093del;5528_5669delinsC;6410_7503del n/a
3 TRCN0000470794 ATAGGCCGCTATTCTGAACGATTT pLX_317 21.3% 28.9% V5 1_4093del;5528_5669delinsC;6410_7503del n/a
4 TRCN0000492028 GACGGTAGGTTTTTAAAGGTTAAT pLX_317 17.8% 28.7% V5 1_4093del;5513_5668del;6410_7503delinsG n/a
5 TRCN0000488105 AGTGCTTGTTGTCAAGCATAGGAG pLX_317 14% 28.7% V5 (not translated due to prior stop codon) 1_4093del;5513_5668del;6410_7503del n/a
Download CSV