Construct: ORF TRCN0000470853
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007046.1_s317c1
- Derived from:
- ccsbBroadEn_15819
- DNA Barcode:
- TAAACTCTGATTATTAATTGGTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MEMO1 (51072)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470853
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001301833.3 | 100% | 100% | |
| 2 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001371914.1 | 100% | 100% | |
| 3 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001371915.1 | 100% | 100% | |
| 4 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_015955.4 | 100% | 100% | |
| 5 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001371913.1 | 97% | 97% | 1_27del |
| 6 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001137602.3 | 92.2% | 92.2% | 142_143ins69 |
| 7 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001371916.1 | 92.2% | 92.2% | 142_143ins69 |
| 8 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001371912.1 | 88.1% | 88.1% | 59_178del |
| 9 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001301852.3 | 67.6% | 34% | 0_1ins145;291_292ins143 |
| 10 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001371917.1 | 67.6% | 34% | 0_1ins145;291_292ins143 |
| 11 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001371918.1 | 67.6% | 34% | 0_1ins145;291_292ins143 |
| 12 | human | 51072 | MEMO1 | mediator of cell motility 1 | XM_011532896.2 | 67.6% | 34% | 0_1ins145;291_292ins143 |
| 13 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001371920.1 | 67% | 67% | 143_144ins294 |
| 14 | human | 51072 | MEMO1 | mediator of cell motility 1 | NM_001371921.1 | 63.6% | 37.8% | 0_1ins181;255_256ins143 |
| 15 | human | 51072 | MEMO1 | mediator of cell motility 1 | NR_163998.1 | 10.1% | 1_84del;663_664ins77;899_7959del | |
| 16 | human | 51072 | MEMO1 | mediator of cell motility 1 | NR_163997.1 | 9.6% | 1_447del;1026_1027ins77;1262_8322del | |
| 17 | human | 51072 | MEMO1 | mediator of cell motility 1 | NR_163996.1 | 8.3% | 1_84del;520_521ins220;756_7816del | |
| 18 | human | 51072 | MEMO1 | mediator of cell motility 1 | NR_163995.1 | 8.3% | (many diffs) | |
| 19 | human | 51072 | MEMO1 | mediator of cell motility 1 | NR_126032.2 | 8% | 1_417del;853_854ins220;1089_8149del | |
| 20 | human | 51072 | MEMO1 | mediator of cell motility 1 | NR_126034.3 | 8% | (many diffs) | |
| 21 | mouse | 76890 | Memo1 | mediator of cell motility 1 | NM_133771.2 | 96% | 99.3% | (many diffs) |
| 22 | mouse | 76890 | Memo1 | mediator of cell motility 1 | XM_006525109.3 | 96% | 99.3% | (many diffs) |
| 23 | mouse | 76890 | Memo1 | mediator of cell motility 1 | XM_011246712.2 | 64.9% | 35.4% | (many diffs) |
| 24 | mouse | 76890 | Memo1 | mediator of cell motility 1 | XM_011246713.2 | 64.9% | 35.4% | (many diffs) |
| 25 | mouse | 76890 | Memo1 | mediator of cell motility 1 | XR_001782128.1 | 27.3% | (many diffs) | |
| 26 | mouse | 76890 | Memo1 | mediator of cell motility 1 | XR_876585.2 | 25.5% | (many diffs) | |
| 27 | mouse | 76890 | Memo1 | mediator of cell motility 1 | XR_385390.3 | 24.6% | (many diffs) | |
| 28 | mouse | 76890 | Memo1 | mediator of cell motility 1 | XR_385387.3 | 24.4% | (many diffs) | |
| 29 | mouse | 76890 | Memo1 | mediator of cell motility 1 | XR_876587.2 | 18.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 957
- ORF length:
- 891
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc caaccgagtg gtctgccgag aagccagtca cgccgggagc tggtacacag 121 cctcaggacc gcagctgaat gcacagctag aaggttggct ttcacaagta cagtctacaa 181 aaagacctgc tagagccatt attgcccccc atgcaggata tacgtactgt gggtcttgtg 241 ctgcccatgc ttataaacaa gtggatccgt ctattacccg gagaattttc atccttgggc 301 cttctcatca tgtgcccctc tctcgatgtg cactttccag tgtggatata tataggacac 361 ctctgtatga ccttcgtatt gaccaaaaga tttacggaga actgtggaag acaggaatgt 421 ttgaacgcat gtctctgcag acagatgaag atgaacacag tattgaaatg catttgcctt 481 atacagctaa agccatggaa agccataagg atgagtttac cattattcct gtactggttG 541 GAGCTCTGAG TGAGTCAAAA GAACAGGAAT TCGGAAAACT CTTCAGTAAA TATCTAGCGG 601 ATCCTAGTAA TCTCTTTGTG GTTTCTTCTG ATTTCTGCCA TTGGGGTCAA AGGTTCCGTT 661 ACAGTTACTA TGATGAATCC CAGGGGGAGA TTTATAGATC CATTGAACAT CTAGATAAAA 721 TGGGTATGAG TATTATAGAA CAATTAGACC CTGTATCTTT TAGCAATTAC TTGAAGAAAT 781 ACCATAATAC TATATGTGGA AGACATCCCA TTGGGGTGTT ATTAAATGCT ATCACAGAGC 841 TCCAGAAGAA TGGAATGAAT ATGAGTTTTT CGTTTTTGAA TTATGCCCAG TCGAGCCAGT 901 GTAGAAACTG GCAAGACAGT TCAGTGAGTT ATGCAGCTGG AGCACTCACG GTCCACTGCC 961 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1021 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1081 ATATATCTTG TGGAAAGGAC GATAAACTCT GATTATTAAT TGGTATACGC GTTAAGTCga 1141 caatcaacct ctggattaca aaatttgtga aagatt