Transcript: Mouse XR_385390.3

PREDICTED: Mus musculus mediator of cell motility 1 (Memo1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Memo1 (76890)
Length:
3086
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385390.3
NBCI Gene record:
Memo1 (76890)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258053 TATCTAGCGGATCCTAGTAAT pLKO_005 655 3UTR 100% 13.200 18.480 N Memo1 n/a
2 TRCN0000265278 ACTCTCCAGTGTGGATATATA pLKO_005 396 3UTR 100% 15.000 10.500 N Memo1 n/a
3 TRCN0000250449 AGACCTGCTAGAGCCATTATT pLKO_005 247 3UTR 100% 15.000 10.500 N Memo1 n/a
4 TRCN0000250451 CTCCTTAATTTCAACTCATTT pLKO_005 1096 3UTR 100% 13.200 9.240 N Memo1 n/a
5 TRCN0000215789 CATTTGCCTTATACAGCTAAA pLKO.1 535 3UTR 100% 10.800 7.560 N Memo1 n/a
6 TRCN0000250450 CATTTGCCTTATACAGCTAAA pLKO_005 535 3UTR 100% 10.800 7.560 N Memo1 n/a
7 TRCN0000201481 CCTAGCCTTTACCAAGATGTT pLKO.1 1003 3UTR 100% 4.950 3.465 N Memo1 n/a
8 TRCN0000122896 TGGAGCTCTGAGTGAGTCAAA pLKO.1 603 3UTR 100% 4.950 3.465 N MEMO1 n/a
9 TRCN0000352982 TGGAGCTCTGAGTGAGTCAAA pLKO_005 603 3UTR 100% 4.950 3.465 N MEMO1 n/a
10 TRCN0000201731 GCCTTTACCAAGATGTTGGTT pLKO.1 1007 3UTR 100% 0.300 0.210 N Memo1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15819 pDONR223 0% 24.6% None (many diffs) n/a
2 ccsbBroad304_15819 pLX_304 0% 24.6% V5 (many diffs) n/a
3 TRCN0000470853 TAAACTCTGATTATTAATTGGTAT pLX_317 46.9% 24.6% V5 (many diffs) n/a
4 ccsbBroadEn_08210 pDONR223 100% 24.5% None (many diffs) n/a
5 ccsbBroad304_08210 pLX_304 0% 24.5% V5 (many diffs) n/a
6 TRCN0000468812 CTTGATACTTGGCAAGCCATTGTG pLX_317 46.2% 24.5% V5 (many diffs) n/a
Download CSV