Construct: ORF TRCN0000470873
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001343.1_s317c1
- Derived from:
- ccsbBroadEn_00219
- DNA Barcode:
- CCCTAGGACTGTTTTGAGTCGAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CARS1 (833)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470873
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | NM_001751.6 | 100% | 100% | |
| 2 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | NM_139273.4 | 96.3% | 94.2% | 2111_2118delATGTAAGC;2178_2179ins74 |
| 3 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XM_024448703.1 | 95.4% | 95.4% | 1274_1381del |
| 4 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XM_006718341.3 | 94.5% | 94.5% | 0_1ins77;38_84del |
| 5 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XM_017018392.2 | 94.2% | 92% | (many diffs) |
| 6 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XM_017018389.1 | 91% | 88.9% | (many diffs) |
| 7 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XM_017018390.1 | 91% | 88.9% | (many diffs) |
| 8 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XM_024448704.1 | 90.3% | 90.2% | 0_1ins77;38_84del;1244_1351del |
| 9 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | NM_001014437.3 | 89.8% | 89.1% | (many diffs) |
| 10 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XM_017018391.1 | 87.7% | 87.7% | 0_1ins276 |
| 11 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | NM_001194997.2 | 86.5% | 84% | (many diffs) |
| 12 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XM_024448701.1 | 86% | 85.4% | (many diffs) |
| 13 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XR_001747995.2 | 86% | 1_56del;2085_2205del;2422_2609del | |
| 14 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XR_001747996.2 | 85.7% | (many diffs) | |
| 15 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XM_024448705.1 | 83.6% | 83.6% | 0_1ins276;998_1105del |
| 16 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XM_024448702.1 | 82.9% | 80.5% | (many diffs) |
| 17 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XR_930914.2 | 80.9% | (many diffs) | |
| 18 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XR_001747998.1 | 80.7% | (many diffs) | |
| 19 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | NR_036542.2 | 80.4% | (many diffs) | |
| 20 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XR_930913.1 | 78.1% | (many diffs) | |
| 21 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XR_001747997.1 | 77% | (many diffs) | |
| 22 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XR_002957203.1 | 75.4% | (many diffs) | |
| 23 | human | 833 | CARS1 | cysteinyl-tRNA synthetase 1 | XR_002957204.1 | 75.2% | (many diffs) | |
| 24 | mouse | 27267 | Cars | cysteinyl-tRNA synthetase | NM_001252593.1 | 85.7% | 90.2% | (many diffs) |
| 25 | mouse | 27267 | Cars | cysteinyl-tRNA synthetase | NM_013742.5 | 76.9% | 80.9% | (many diffs) |
| 26 | mouse | 27267 | Cars | cysteinyl-tRNA synthetase | XM_011242000.1 | 75.2% | 79.1% | (many diffs) |
| 27 | mouse | 27267 | Cars | cysteinyl-tRNA synthetase | XM_011242001.1 | 75.2% | 79.1% | (many diffs) |
| 28 | mouse | 27267 | Cars | cysteinyl-tRNA synthetase | XM_006508627.2 | 74.9% | 78.9% | (many diffs) |
| 29 | mouse | 27267 | Cars | cysteinyl-tRNA synthetase | XR_378611.2 | 67.9% | (many diffs) | |
| 30 | mouse | 27267 | Cars | cysteinyl-tRNA synthetase | XM_017322295.1 | 62.6% | 65.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2310
- ORF length:
- 2244
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agattcctcc gggcagcagg gcaaaggccg gcgtgtgcag ccccagtggt 121 cccctcctgc tgggacccag ccatgcagac tccaccttta caacagcctc accaggaaca 181 aggaagtgtt catacctcaa gatgggaaaa aggtgacgtg gtattgctgt gggccaaccg 241 tctatgacgc atctcacatg gggcacgcca ggtcctacat ctcttttgat atcttgagaa 301 gagtgttgaa ggattacttc aaatttgatg tcttttattg catgaacatt acggatattg 361 atgacaagat catcaagagg gcccggcaga accacctgtt cgagcagtat cgggagaaga 421 ggcctgaagc ggcacagctc ttggaggatg ttcaggccgc cctgaagcca ttttcagtaa 481 aattaaatga gaccacggat cccgataaaa agcagatgct cgaacggatt cagcacgcag 541 tgcagcttgc cacagagcca cttgagaaag ctgtgcagtc cagactcacg ggagaggaag 601 tcaacagctg tgtggaggtg ttgctggaag aagccaagga tttgctctct gactggctgg 661 attctacact tggctgtgat gtcactgaca attccatctt ctccaagctg cccaagttct 721 gggaggggga cttccacaga gacatggaag ctctgaatgt tctccctcca gatgtcttaa 781 cccgggttag tgagtatgtg ccagaaattg tgaactttgt ccagaagatt gtggacaacg 841 gttacggcta tgtctccaat gggtctgtct actttgatac agcgaagttt gcttctagcg 901 agaagcactc ctatgggaag ctggtgcctg aggccgttgg agatcagaaa gcccttcaag 961 aaggggaagg tgacctgagc atctctgcag accgcctgag tgagaagcgc tctcccaacg 1021 actttgcctt atggaaggcc tctaagcccg gagaaccgtc ctggccgtgc ccttggggaa 1081 agggtcgtcc gggctggcat atcgagtgct cggccatggc aggcaccctc ctaggggctt 1141 cgatggacat tcacggaggt gggttcgacc tccggttccc ccaccatgac aatgagctgg 1201 cacagtcgga ggcctacttt gaaaacgact gctgggtcag gtacttcctg cacacaggcc 1261 acctgaccat tgcaggctgc aaaatgtcaa agtcactaaa aaacttcatc accattaaag 1321 atgccttgaa aaagcactca gcacggcagt tgcggctggc cttcctcatg cactcgtgga 1381 aggacaccct ggactactcc agcaacacca tggagtcagc gcttcaatat gagaagttct 1441 tgaatgagtt tttcttaaat gtgaaagata tccttcgcgc tcctgttgac atcactggtc 1501 agtttgagaa gtggggagaa gaagaagcag aactgaataa gaacttttat gacaagaaga 1561 cagcaattca caaagccctc tgtgacaatg ttgacacccg caccgtcatg gaagagatgc 1621 gggccttggt cagtcagtgc aacctctata tggcagcccg gaaagccgtg aggaagaggc 1681 ccaaccaggc tctgctggag aacatcgccc tgtacctcac ccatatgctg aagatctttg 1741 gggccgtaga agaggacagc tccctgggat tcccggtcgg agggcctgga accagcctca 1801 gtctcgaggc cacagtcatg ccctaccttc aggtgttatc agaattccga gaaggagtgc 1861 ggaagattgc ccgagagcaa aaagtccctg agattctgca gctcagcgat gcccTGCGGG 1921 ACAACATCCT GCCCGAGCTT GGGGTGCGGT TTGAAGACCA CGAAGGACTG CCCACAGTGG 1981 TGAAACTGGT AGACAGAAAC ACCTTATTAA AAGAGAGAGA AGAAAAGAGA CGGGTTGAAG 2041 AGGAGAAGAG GAAGAAGAAA GAGGAGGCGG CCCGGAGGAA ACAGGAACAA GAAGCAGCAA 2101 AGCTGGCCAA GATGAAGATT CCCCCCAGTG AGATGTTCTT GTCAGAAACC GACAAATACT 2161 CCAAGTTTGA TGAAAATGGT CTGCCCACAC ATGACATGGA GGGCAAAGAG CTCAGCAAAG 2221 GGCAAGCCAA GAAGCTGAAG AAGCTCTTCG AGGCTCAGGA GAAGCTCTAC AAGGAATATC 2281 TGCAGATGGC CCAGAATGGA AGCTTCCAGT GCCCAACTTT CTTGTACAAA GTGGTTGATA 2341 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 2401 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACCCTA 2461 GGACTGTTTT GAGTCGAGCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2521 tgaaagatt