Transcript: Human NR_036542.2

Homo sapiens cysteinyl-tRNA synthetase 1 (CARS1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-17
Taxon:
Homo sapiens (human)
Gene:
CARS1 (833)
Length:
2784
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_036542.2
NBCI Gene record:
CARS1 (833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_036542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045756 GAAGTGTTCATACCTCAAGAT pLKO.1 470 3UTR 100% 4.950 6.930 N CARS1 n/a
2 TRCN0000290712 GAAGTGTTCATACCTCAAGAT pLKO_005 470 3UTR 100% 4.950 6.930 N CARS1 n/a
3 TRCN0000045757 GTAGACAGAAACACCTTATTA pLKO.1 2276 3UTR 100% 15.000 10.500 N CARS1 n/a
4 TRCN0000290780 GTAGACAGAAACACCTTATTA pLKO_005 2276 3UTR 100% 15.000 10.500 N CARS1 n/a
5 TRCN0000045754 GCTGTGATGTCACTGACAATT pLKO.1 960 3UTR 100% 13.200 9.240 N CARS1 n/a
6 TRCN0000290710 GCTGTGATGTCACTGACAATT pLKO_005 960 3UTR 100% 13.200 9.240 N CARS1 n/a
7 TRCN0000045755 CCTCACCCATATGCTGAAGAT pLKO.1 2002 3UTR 100% 0.000 0.000 N CARS1 n/a
8 TRCN0000290711 CCTCACCCATATGCTGAAGAT pLKO_005 2002 3UTR 100% 0.000 0.000 N CARS1 n/a
9 TRCN0000045753 GCAAGCCAAGAAGCTGAAGAA pLKO.1 2509 3UTR 100% 4.950 2.970 N CARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_036542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00219 pDONR223 100% 80.4% None (many diffs) n/a
2 ccsbBroad304_00219 pLX_304 0% 80.4% V5 (many diffs) n/a
3 TRCN0000470873 CCCTAGGACTGTTTTGAGTCGAGC pLX_317 17.9% 80.4% V5 (many diffs) n/a
Download CSV