Transcript: Mouse NM_001252593.1

Mus musculus cysteinyl-tRNA synthetase (Cars), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cars (27267)
Length:
2987
CDS:
85..2331

Additional Resources:

NCBI RefSeq record:
NM_001252593.1
NBCI Gene record:
Cars (27267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252593.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076294 CGGAACAAGGATGTATTTATA pLKO.1 193 CDS 100% 15.000 21.000 N Cars n/a
2 TRCN0000294986 TGCAGGCTCCGCCTCTATAAT pLKO_005 163 CDS 100% 15.000 21.000 N Cars n/a
3 TRCN0000076297 ACCCGGAACAAGGATGTATTT pLKO.1 190 CDS 100% 13.200 18.480 N Cars n/a
4 TRCN0000076296 CGAAAGATTGCCCGAGAGAAA pLKO.1 1879 CDS 100% 4.950 6.930 N Cars n/a
5 TRCN0000287496 CGAAAGATTGCCCGAGAGAAA pLKO_005 1879 CDS 100% 4.950 6.930 N Cars n/a
6 TRCN0000076295 CCAAGTTTGCTGCTAGTGAAA pLKO.1 902 CDS 100% 4.950 3.960 N Cars n/a
7 TRCN0000287497 CCAAGTTTGCTGCTAGTGAAA pLKO_005 902 CDS 100% 4.950 3.960 N Cars n/a
8 TRCN0000076293 CCGAGGAATTTCCCTCACATT pLKO.1 2604 3UTR 100% 4.950 3.960 N Cars n/a
9 TRCN0000294984 TATGGACTAGGCCACAGCTAC pLKO_005 2375 3UTR 100% 4.050 2.835 N Cars n/a
10 TRCN0000294985 AGATTGTGGACAATGGTTATG pLKO_005 845 CDS 100% 10.800 6.480 N Cars n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252593.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00219 pDONR223 100% 85.7% 90.2% None (many diffs) n/a
2 ccsbBroad304_00219 pLX_304 0% 85.7% 90.2% V5 (many diffs) n/a
3 TRCN0000470873 CCCTAGGACTGTTTTGAGTCGAGC pLX_317 17.9% 85.7% 90.2% V5 (many diffs) n/a
Download CSV