Construct: ORF TRCN0000471073
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017613.1_s317c1
- Derived from:
- ccsbBroadEn_01931
- DNA Barcode:
- TGGTCGCCCGGCTGGACGACAAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TPST2 (8459)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471073
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8459 | TPST2 | tyrosylprotein sulfotransfe... | NM_001008566.3 | 100% | 100% | |
| 2 | human | 8459 | TPST2 | tyrosylprotein sulfotransfe... | NM_001362922.2 | 100% | 100% | |
| 3 | human | 8459 | TPST2 | tyrosylprotein sulfotransfe... | NM_003595.5 | 100% | 100% | |
| 4 | human | 8459 | TPST2 | tyrosylprotein sulfotransfe... | NM_001362923.2 | 87.4% | 87.4% | 1_162del |
| 5 | human | 8459 | TPST2 | tyrosylprotein sulfotransfe... | XM_024452294.1 | 84.3% | 84.3% | 1_210del |
| 6 | mouse | 22022 | Tpst2 | protein-tyrosine sulfotrans... | NM_001326590.1 | 85.7% | 91% | (many diffs) |
| 7 | mouse | 22022 | Tpst2 | protein-tyrosine sulfotrans... | NM_009419.4 | 85.7% | 91% | (many diffs) |
| 8 | mouse | 22022 | Tpst2 | protein-tyrosine sulfotrans... | XM_006534850.2 | 85.7% | 91% | (many diffs) |
| 9 | mouse | 22022 | Tpst2 | protein-tyrosine sulfotrans... | XM_017320800.1 | 85.7% | 91% | (many diffs) |
| 10 | mouse | 22022 | Tpst2 | protein-tyrosine sulfotrans... | XM_006534849.3 | 75.8% | 80.5% | (many diffs) |
| 11 | mouse | 22022 | Tpst2 | protein-tyrosine sulfotrans... | XR_389265.2 | 56.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1197
- ORF length:
- 1131
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg cctgtcggtg cggagggtgc tgctggcagc cggctgcgcc ctggtcctgg 121 tgctggcggt tcagctggga cagcaggtgc tagagtgccg ggcggtgctg gcgggcctgc 181 ggagcccccg gggggccatg cggcctgagc aggaggagct ggtgatggtg ggcaccaacc 241 acgtggaata ccgctatggc aaggccatgc cgctcatctt cgtgggtggc gtgcctcgca 301 gtggcaccac gttgatgcgc gccatgctgg acgcgcaccc cgaggtgcgc tgcggcgagg 361 agacccgcat catcccgcgc gtgctggcca tgcgccaggc ctggtccaag tctggccgtg 421 agaagctgcg gctggatgag gcgggggtga cggatgaggt gctggacgcc gccatgcagg 481 ccttcatcct ggaggtgatt gccaagcacg gagagccggc ccgcgtgctc tgcaacaagg 541 acccatttac gctcaagtcc tcggtctacc tgtcgcgcct gttccccaac tccaagttcc 601 tgctgatggt gcgggacggc cgggcctccg tgcactccat gatcacgcgc aaagtcacca 661 ttgcgggctt tgaccTCAGC AGCTACCGTG ACTGCCTCAC CAAGTGGAAC AAGGCCATCG 721 AGGTGATGTA CGCCCAGTGC ATGGAGGTAG GCAAGGAGAA GTGCCTGCCT GTGTACTACG 781 AGCAGCTGGT GCTGCACCCC AGGCGCTCAC TCAAGCTCAT CCTCGACTTC CTCGGCATCG 841 CCTGGAGCGA CGCTGTCCTC CACCATGAAG ACCTCATTGG CAAGCCCGGT GGTGTCTCCC 901 TGTCCAAGAT CGAGCGGTCC ACGGACCAGG TCATCAAGCC TGTTAACCTG GAAGCGCTCT 961 CCAAGTGGAC TGGCCACATC CCTGGGGATG TGGTGCGGGA CATGGCCCAG ATCGCCCCCA 1021 TGCTGGCTCA GCTCGGCTAT GACCCTTATG CAAACCCCCC CAACTATGGC AACCCTGACC 1081 CCTTCGTCAT CAACAACACA CAGCGGGTCT TGAAAGGGGA CTATAAAACA CCAGCCAATC 1141 TGAAAGGATA TTTTCAGGTG AACCAGAACA GCACCTCCTC CCACTTAGGA AGCTCGTGCC 1201 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1261 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1321 ATATATCTTG TGGAAAGGAC GATGGTCGCC CGGCTGGACG ACAAAGACGC GTTAAGTCga 1381 caatcaacct ctggattaca aaatttgtga aagatt