Transcript: Human NM_001362922.2

Homo sapiens tyrosylprotein sulfotransferase 2 (TPST2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
TPST2 (8459)
Length:
5581
CDS:
169..1302

Additional Resources:

NCBI RefSeq record:
NM_001362922.2
NBCI Gene record:
TPST2 (8459)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362922.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035732 CGTGGAATACCGCTATGGCAA pLKO.1 345 CDS 100% 2.640 3.696 N TPST2 n/a
2 TRCN0000103137 CAGCCAATCTGAAAGGATATT pLKO.1 1235 CDS 100% 13.200 9.240 N Tpst2 n/a
3 TRCN0000326471 CAGCCAATCTGAAAGGATATT pLKO_005 1235 CDS 100% 13.200 9.240 N Tpst2 n/a
4 TRCN0000035729 CCAGCCAATCTGAAAGGATAT pLKO.1 1234 CDS 100% 10.800 7.560 N TPST2 n/a
5 TRCN0000289865 CCAGCCAATCTGAAAGGATAT pLKO_005 1234 CDS 100% 10.800 7.560 N TPST2 n/a
6 TRCN0000035730 CTCTGCAACAAGGACCCATTT pLKO.1 631 CDS 100% 10.800 7.560 N TPST2 n/a
7 TRCN0000289866 CTCTGCAACAAGGACCCATTT pLKO_005 631 CDS 100% 10.800 7.560 N TPST2 n/a
8 TRCN0000035731 CTCCACCATGAAGACCTCATT pLKO.1 961 CDS 100% 4.950 3.465 N TPST2 n/a
9 TRCN0000289938 CTCCACCATGAAGACCTCATT pLKO_005 961 CDS 100% 4.950 3.465 N TPST2 n/a
10 TRCN0000035733 CAACTCCAAGTTCCTGCTGAT pLKO.1 690 CDS 100% 4.050 2.835 N TPST2 n/a
11 TRCN0000289937 CAACTCCAAGTTCCTGCTGAT pLKO_005 690 CDS 100% 4.050 2.835 N TPST2 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2083 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2084 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3878 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362922.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01931 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01931 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471073 TGGTCGCCCGGCTGGACGACAAAG pLX_317 46.2% 100% 100% V5 n/a
4 ccsbBroadEn_15633 pDONR223 0% 99.7% 100% None 270G>C;276C>T;700C>T n/a
5 ccsbBroad304_15633 pLX_304 0% 99.7% 100% V5 270G>C;276C>T;700C>T n/a
6 TRCN0000478977 AACTGGCGCCCGTTTGTGTACGTG pLX_317 32.4% 99.7% 100% V5 270G>C;276C>T;700C>T n/a
Download CSV