Transcript: Mouse XR_389265.2

PREDICTED: Mus musculus protein-tyrosine sulfotransferase 2 (Tpst2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tpst2 (22022)
Length:
1226
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_389265.2
NBCI Gene record:
Tpst2 (22022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_389265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103139 CAACTCCAAATTCCTGCTAAT pLKO.1 754 3UTR 100% 10.800 7.560 N Tpst2 n/a
2 TRCN0000103138 CCCAACTCCAAATTCCTGCTA pLKO.1 752 3UTR 100% 2.640 1.848 N Tpst2 n/a
3 TRCN0000326472 CCCAACTCCAAATTCCTGCTA pLKO_005 752 3UTR 100% 2.640 1.848 N Tpst2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_389265.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01931 pDONR223 100% 56.5% None (many diffs) n/a
2 ccsbBroad304_01931 pLX_304 0% 56.5% V5 (many diffs) n/a
3 TRCN0000471073 TGGTCGCCCGGCTGGACGACAAAG pLX_317 46.2% 56.5% V5 (many diffs) n/a
4 ccsbBroadEn_15633 pDONR223 0% 56.4% None (many diffs) n/a
5 ccsbBroad304_15633 pLX_304 0% 56.4% V5 (many diffs) n/a
6 TRCN0000478977 AACTGGCGCCCGTTTGTGTACGTG pLX_317 32.4% 56.4% V5 (many diffs) n/a
Download CSV