Construct: ORF TRCN0000471089
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016284.1_s317c1
- Derived from:
- ccsbBroadEn_00647
- DNA Barcode:
- GATGCTGGGTGATTGAACTATGAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GLRA2 (2742)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471089
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2742 | GLRA2 | glycine receptor alpha 2 | NM_001118885.1 | 100% | 100% | |
2 | human | 2742 | GLRA2 | glycine receptor alpha 2 | NM_002063.4 | 100% | 100% | |
3 | human | 2742 | GLRA2 | glycine receptor alpha 2 | NM_001118886.2 | 99% | 99.5% | (many diffs) |
4 | human | 2742 | GLRA2 | glycine receptor alpha 2 | XM_017029427.1 | 99% | 99.5% | (many diffs) |
5 | human | 2742 | GLRA2 | glycine receptor alpha 2 | XM_006724487.3 | 96.2% | 95.1% | (many diffs) |
6 | human | 2742 | GLRA2 | glycine receptor alpha 2 | XM_011545496.2 | 96.2% | 95.1% | (many diffs) |
7 | human | 2742 | GLRA2 | glycine receptor alpha 2 | XM_024452365.1 | 96.2% | 95.1% | (many diffs) |
8 | human | 2742 | GLRA2 | glycine receptor alpha 2 | NM_001171942.1 | 80.3% | 80.3% | 0_1ins267 |
9 | human | 2742 | GLRA2 | glycine receptor alpha 2 | XM_017029428.2 | 80.3% | 80.3% | 0_1ins267 |
10 | human | 2742 | GLRA2 | glycine receptor alpha 2 | XM_017029429.2 | 80.3% | 80.3% | 0_1ins267 |
11 | human | 2742 | GLRA2 | glycine receptor alpha 2 | XM_024452366.1 | 80.3% | 80.3% | 0_1ins267 |
12 | mouse | 237213 | Glra2 | glycine receptor, alpha 2 s... | NM_183427.4 | 92.8% | 98.6% | (many diffs) |
13 | mouse | 237213 | Glra2 | glycine receptor, alpha 2 s... | XM_006528834.1 | 92.8% | 98.6% | (many diffs) |
14 | mouse | 237213 | Glra2 | glycine receptor, alpha 2 s... | XM_006528835.3 | 92.8% | 98.6% | (many diffs) |
15 | mouse | 237213 | Glra2 | glycine receptor, alpha 2 s... | XM_006528833.1 | 91.9% | 98.2% | (many diffs) |
16 | mouse | 237213 | Glra2 | glycine receptor, alpha 2 s... | XM_006528836.3 | 82.3% | 88.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1422
- ORF length:
- 1356
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ccggcagcta gtgaacattt tgacagcctt gtttgcattt ttcttagaga 121 caaaccactt caggacggct ttctgcaaag accatgactc caggtctgga aaacaacctt 181 cacagaccct atctccttca gatttcttgg acaagttaat gggaaggaca tcaggatatg 241 atgcaagaat caggccaaat tttaaaggtc ctccagtaaa cgttacttgc aatattttta 301 tcaacagttt tggatcagtc acagaaacga ccatggacta ccgagtgaat atttttctga 361 gacaacagtg gaatgattca cggctggcgt acagtgagta cccagatgac tccctggact 421 tggacccatc catgctagac tccatttgga aaccagattt gttctttgcc aatgagaagg 481 gtgccaactt ccacgatgtc accactgaca acaaattgct acggatttcg aaaaatggca 541 aagtgctcta cagtatcaga ctcaccttga ccttatcctg tcccatggac ttgaagaact 601 ttccgatgga tgtccagacc tgtacaatgc agctggagag ttttgggtac acgatgaatg 661 acctgatatt tgagtggtta agtgatggtc cagtgcaagt tgctgaagga ttgaccctgc 721 cccagtttat tttgaaagaa gagaaggaac ttggctactg tacaaagcac tacaacactg 781 gaaagtttac ctgcattgag gtcaagtttc atctggaacg ccaaatggga tattatttga 841 tccagatgta catcccaagc ctgcttatag taattttgtc ctgggtttcc ttttggataa 901 atatggatgc agcccctgcc agggtcgcac tgggcatcac cacagtctta acgatgacca 961 cccagagttc aggctccagg gcatctctgc caaaggtctc ctatgtaaaa gcgattgaca 1021 tctggatggc ggtgtgcctt ctgtttgTGT TTGCTGCCTT ACTGGAATAC GCAGCGGTGA 1081 ACTTCGTCTC CAGGCAACAC AAGGAGTTCC TGCGCCTCCG AAGAAGACAG AAGAGGCAGA 1141 ATAAGGAAGA AGACGTTACT CGTGAAAGTC GTTTTAATTT TAGCGGTTAT GGGATGGGTC 1201 ACTGCCTCCA AGTGAAAGAT GGAACAGCTG TCAAGGCCAC ACCTGCCAAC CCACTCCCAC 1261 AACCGCCAAA AGATGGAGAT GCTATCAAGA AGAAGTTTGT GGACCGGGCA AAAAGGATTG 1321 ACACGATATC TCGAGCTGCC TTCCCATTGG CCTTCCTCAT TTTCAACATC TTTTACTGGA 1381 TCACATACAA GATCATTCGG CATGAAGATG TCCACAAGAA ATACCCAACT TTCTTGTACA 1441 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1501 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1561 AGGACGAGAT GCTGGGTGAT TGAACTATGA GACGCGTTAA GTCgacaatc aacctctgga 1621 ttacaaaatt tgtgaaagat t