Transcript: Human XM_017029428.2

PREDICTED: Homo sapiens glycine receptor alpha 2 (GLRA2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLRA2 (2742)
Length:
2045
CDS:
862..1953

Additional Resources:

NCBI RefSeq record:
XM_017029428.2
NBCI Gene record:
GLRA2 (2742)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029428.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061668 GCACTACAACACTGGAAAGTT pLKO.1 1296 CDS 100% 5.625 7.875 N GLRA2 n/a
2 TRCN0000061669 GCCAAAGGTCTCCTATGTAAA pLKO.1 1518 CDS 100% 13.200 9.240 N GLRA2 n/a
3 TRCN0000061671 GATGCTATCAAGAAGAAGTTT pLKO.1 1807 CDS 100% 5.625 3.938 N GLRA2 n/a
4 TRCN0000061672 AGACCCTATCTCCTTCAGATT pLKO.1 645 5UTR 100% 4.950 3.465 N GLRA2 n/a
5 TRCN0000061670 GACCTGATATTTGAGTGGTTA pLKO.1 1189 CDS 100% 4.950 3.465 N GLRA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029428.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00647 pDONR223 100% 80.3% 80.3% None 0_1ins267 n/a
2 ccsbBroad304_00647 pLX_304 0% 80.3% 80.3% V5 0_1ins267 n/a
3 TRCN0000471089 GATGCTGGGTGATTGAACTATGAG pLX_317 27.9% 80.3% 80.3% V5 0_1ins267 n/a
Download CSV