Transcript: Mouse XM_006528833.1

PREDICTED: Mus musculus glycine receptor, alpha 2 subunit (Glra2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Glra2 (237213)
Length:
3168
CDS:
543..1901

Additional Resources:

NCBI RefSeq record:
XM_006528833.1
NBCI Gene record:
Glra2 (237213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089393 GCGTAATTGATTTACTGGTAT pLKO.1 2618 3UTR 100% 4.950 3.960 N Glra2 n/a
2 TRCN0000089397 CCTTCAGATTTCTTGGATAAA pLKO.1 672 CDS 100% 13.200 9.240 N Glra2 n/a
3 TRCN0000089395 CCCAGATGATTCCCTGGATTT pLKO.1 878 CDS 100% 10.800 7.560 N Glra2 n/a
4 TRCN0000061671 GATGCTATCAAGAAGAAGTTT pLKO.1 1755 CDS 100% 5.625 3.938 N GLRA2 n/a
5 TRCN0000061672 AGACCCTATCTCCTTCAGATT pLKO.1 661 CDS 100% 4.950 3.465 N GLRA2 n/a
6 TRCN0000089396 CCCAGCCTGTTGATAGTCATT pLKO.1 1332 CDS 100% 4.950 3.465 N Glra2 n/a
7 TRCN0000089394 CCCTCAATGTTGGATTCGATT pLKO.1 903 CDS 100% 4.950 3.465 N Glra2 n/a
8 TRCN0000061670 GACCTGATATTTGAGTGGTTA pLKO.1 1137 CDS 100% 4.950 3.465 N GLRA2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2283 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00647 pDONR223 100% 91.9% 98.2% None (many diffs) n/a
2 ccsbBroad304_00647 pLX_304 0% 91.9% 98.2% V5 (many diffs) n/a
3 TRCN0000471089 GATGCTGGGTGATTGAACTATGAG pLX_317 27.9% 91.9% 98.2% V5 (many diffs) n/a
Download CSV