Transcript: Human NM_002063.4

Homo sapiens glycine receptor alpha 2 (GLRA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GLRA2 (2742)
Length:
3208
CDS:
523..1881

Additional Resources:

NCBI RefSeq record:
NM_002063.4
NBCI Gene record:
GLRA2 (2742)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002063.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061668 GCACTACAACACTGGAAAGTT pLKO.1 1224 CDS 100% 5.625 7.875 N GLRA2 n/a
2 TRCN0000061669 GCCAAAGGTCTCCTATGTAAA pLKO.1 1446 CDS 100% 13.200 9.240 N GLRA2 n/a
3 TRCN0000061671 GATGCTATCAAGAAGAAGTTT pLKO.1 1735 CDS 100% 5.625 3.938 N GLRA2 n/a
4 TRCN0000061672 AGACCCTATCTCCTTCAGATT pLKO.1 641 CDS 100% 4.950 3.465 N GLRA2 n/a
5 TRCN0000061670 GACCTGATATTTGAGTGGTTA pLKO.1 1117 CDS 100% 4.950 3.465 N GLRA2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2327 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002063.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00647 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00647 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471089 GATGCTGGGTGATTGAACTATGAG pLX_317 27.9% 100% 100% V5 n/a
Download CSV