Construct: ORF TRCN0000471109
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009587.1_s317c1
- Derived from:
- ccsbBroadEn_14181
- DNA Barcode:
- TCGACATCCTTTCTGCGCACGCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- INTS11 (54973)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471109
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54973 | INTS11 | integrator complex subunit 11 | XM_011541650.2 | 63.3% | 63.2% | 1_522del;779T>C |
| 2 | human | 54973 | INTS11 | integrator complex subunit 11 | XM_017001557.1 | 63.3% | 63.2% | 1_522del;779T>C |
| 3 | human | 54973 | INTS11 | integrator complex subunit 11 | XM_017001558.1 | 63.3% | 63.2% | 1_522del;779T>C |
| 4 | human | 54973 | INTS11 | integrator complex subunit 11 | NM_001256463.2 | 60.4% | 60.3% | 1_591del;848T>C |
| 5 | human | 54973 | INTS11 | integrator complex subunit 11 | NM_001256462.1 | 60% | 59.9% | 1_600del;857T>C |
| 6 | human | 54973 | INTS11 | integrator complex subunit 11 | NM_001256460.1 | 52.8% | 52.7% | 1_807del;1064T>C |
| 7 | human | 54973 | INTS11 | integrator complex subunit 11 | NM_017871.6 | 50.2% | 50.1% | 1_894del;1151T>C |
| 8 | human | 54973 | INTS11 | integrator complex subunit 11 | NM_001256456.1 | 49.7% | 49.6% | 1_912del;1169T>C |
| 9 | human | 54973 | INTS11 | integrator complex subunit 11 | XM_011541648.1 | 48.4% | 48.3% | 1_960del;1217T>C |
| 10 | human | 54973 | INTS11 | integrator complex subunit 11 | XM_011541647.1 | 45.7% | 45.6% | 1_1074del;1331T>C |
| 11 | mouse | 71957 | Ints11 | integrator complex subunit 11 | XM_006539195.2 | 85.2% | 95.3% | (many diffs) |
| 12 | mouse | 71957 | Ints11 | integrator complex subunit 11 | XM_006539194.2 | 72.8% | 81.5% | (many diffs) |
| 13 | mouse | 71957 | Ints11 | integrator complex subunit 11 | XM_011250335.2 | 58.7% | 65.7% | (many diffs) |
| 14 | mouse | 71957 | Ints11 | integrator complex subunit 11 | XM_006539192.2 | 54% | 60.5% | (many diffs) |
| 15 | mouse | 71957 | Ints11 | integrator complex subunit 11 | NM_028020.3 | 42.8% | 48% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 972
- ORF length:
- 906
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt tgagttcaag cacatcaagg ccttcgaccg ggcttttgct gacaacccag 121 gaccgatggt tgtgtttgcc acgccaggaa tgctgcacgc tgggcagtcc ctgcagatct 181 tccggaaatg ggccggaaac gaaaagaaca tggtcatcat gcccggctac tgcgtgcagg 241 gcaccgtcgg ccacaagatc ctcagcgggc agcggaagct cgagatggag gggcggcagg 301 tgctggaggt caagatgcag gcggagtaca tgtcattcag cgcacacgcg gacgccaagg 361 gcatcatgca gctggtgggc caggcagagc cggagagcgt gctgctggtg catggcgagg 421 ccaagaagat ggagttcctg aagcagaaga tcgagcagga gctccgggtc aactgctaca 481 tgccggccaa tggcgagacg gtgacgctgc ccacaagccc cagcatcccc gtaggcatct 541 cgctggGGCT GCTGAAGCGG GAGATGGCGC AGGGGCTGCT CCCTGAGGCC AAGAAGCCTC 601 GGCTCCTGCA CGGCACCCTG ATCATGAAGG ACAGCAACTT CCGGCTGGTG TCCTCAGAGC 661 AAGCCCTCAA AGAGCTGGGT CTGGCTGAGC ACCAGCTGCG CTTCACCTGC CGCGTGCACC 721 TGCATGACAC ACGCAAGGAG CAGGAGACGG CATTGCGCGT CTACAGCCAC CTCAAGAGCG 781 TCCTGAAGGA CCACTGTGTG CAGCACCTCC CAGACGGCTC TGTGACTGTG GAGTCCGTCC 841 TCCTCCAGGC CGCCGCCCCT TCTGAGGACC CAGGCACCAA GGTGCTGCTG GTCTCCTGGA 901 CCTACCAGGA CGAGGAGCTG GGGAGCTTCC TCACATCTCT GCTGAAGAAG GGCCTCCCCC 961 AGGCCCCCAG CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1021 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1081 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATCG ACATCCTTTC TGCGCACGCA 1141 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t